snOPY snoRNA Orthological Gene Database
Mus_musculus
U6 snRNA
X06980
106
GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGC
CCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT
SNORD94 C/D
snoU6-53 C/D
snoU6-53 C/D
SNORD67 C/D
snoZ30 C/D
SNORA79 U6:U31,U6:U86 H/ACA
SNORA79 U6:U31,U6:U86 H/ACA
SNORA79 U6:U31,U6:U86 H/ACA
SNORA79 U6:U31,U6:U86 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved