snOPY snoRNA Orthological Gene Database
Mus_musculus
U3 snoRNA
NR_002843
218
aagactatactttcagggatcatttctatagttcgttactagagaagtttctctgactgt
gtagagcacccgaaaccacgaggacgagacgtagcgttccctcctgagcgtgaagccggc
tctaggtgctgcttgactgcagctgcctcctgccattgatgatcgttcttccctcctttg
ggagggtgagagggagggaacgcagtctgagtggacgc
SNORA74 28S:U3418,28S:U3420,U3:U8 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved