snOPY snoRNA Orthological Gene Database
Mus_musculus
28S rRNA
NR_003279
4730
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCAGCGGAGGAA
AAGAAACTAACCAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAAGAGCCCAGCGCCGA
ATCCCCGCCGCGCGTCGCGGCGTGGGAAATGTGGCGTACGGAAGACCCACTCCCCGGCGC
CGCTCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCAGCCCGTGGACGGTGTGAGGCCG
GTAGCGGCCCCGGCGCGCCGGGCTCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCAG
CCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCAAC
AAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAAC
CGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGCG
CGCGTCCGGCCGTGCCCGGTGGTCCCGGCGGATCTTTCCCGCTCCCCGTTCCTCCCGACC
CCTCCACCCGCGCGTCGTTCCCCTCTTCCTCCCCGCGTCCGGCGCCTCCGGCGGCGGGCG
CGGGGGGTGGTGTGGTGGTGGCGCGCGGGCGGGGCCGGGGGTGGGGTCGGCGGGGGACCG
CCCCCGGCCGGCGACCGGCCGCCGCCGGGCGCACTTCCACCGTGGCGGTGCGCCGCGACC
GGCTCCGGGACGGCCGGGAAGGCCCGGTGGGGAAGGTGGCTCGGGGGGGGCGGCGCGTCT
CAGGGCGCGCCGAACCACCTCACCCCGAGTGTTACAGCCCTCCGGCCGCGCTTTCGCCGA
ATCCCGGGGCCGAGGAAGCCAGATACCCGTCGCCGCGCTCTCCCTCTCCCCCCGTCCGCC
TCCCGGGCGGGCGTGGGGGTGGGGGCCGGGCCGCCCCTCCCACGGCGCGACCGCTCTCCC
ACCCCCCTCCGTCGCCTCTCTCGGGGCCCGGTGGGGGGCGGGGCGGACTGTCCCCAGTGC
GCCCCGGGCGTCGTCGCGCCGTCGGGTCCCGGGGGGACCGTCGGTCACGCGTCTCCCGAC
GAAGCCGAGCGCACGGGGTCGGCGGCGATGTCGGCTACCCACCCGACCCGTCTTGAAACA
CGGACCAAGGAGTCTAACGCGTGCGCGAGTCAGGGGCTCGTCCGAAAGCCGCCGTGGCGC
AATGAAGGTGAAGGGCCCCGCCCGGGGGCCCGAGGTGGGATCCCGAGGCCTCTCCAGTCC
GCCGAGGGCGCACCACCGGCCCGTCTCGCCCGCCGCGCCGGGGAGGTGGAGCACGAGCGT
ACGCGTTAGGACCCGAAAGATGGTGAACTATGCTTGGGCAGGGCGAAGCCAGAGGAAACT
CTGGTGGAGGTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGG
CGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCT
GGCGCTCTCGCTCCCGACGTACGCAGTTTTATCCGGTAAAGCGAATGATTAGAGGTCTTG
GGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTG
GCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGG
CGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCC
AGAAAAGGTGTTGGTTGATATAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTA
AGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAG
CGTCGGGCCCATACCCGGCCGTCGCCGCAGTCGGAACGGAACGGGACGGGAGCGGCCGCG
GGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCG
CGCGCCGGGTTCGCCCCCGCGGCGTCGGGCCCCGCGGAGCCTACGCCGCGACGAGTAGGA
GGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGCGGGCCCGGGTGGAGCCGCCGCAGGTG
CAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAG
GGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCC
GTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCGGCCGATCGAAAGGGAGTCGGGTT
CAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCCAGTGCGGTAACGCGAC
CGATCCCGGAGAAGCCGGCGGGAGGCCTCGGGGAGAGTTCTCTTTTCTTTGTGAAGGGCA
GGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGTGCCTTGGAAAGCGTCGCGGT
TCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAATCCGGGGGAGAGGGTGTAAAT
CTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGTGAACAGCCTCTGGCATG
TTGGAACAATGTAGGTAAGGGAAGTCGGCAAGCCGGATCCGTAACTTCGGGATAAGGATT
GGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCGGGGCTGGGCGCGCGCCGCGG
CTGGACGAGGCGCCGCCGCCCTCTCCCACGTCCGGGGAGACCCCCCGTCCTTTCCGCCCG
GGCCCGCCCTCCCCTCTTCCCCGCGGGGCCCCGTCGTCCCCCGCGTCGTCGCCACCTCTC
TTCCCCCCTCCTTCTTCCCGTCGGGGGGCGGGTCGGGGGTCGGCGCGCGGCGCGGGCTCC
GGGGCGGCGGGTCCAACCCCGCGGGGGTTCCGGAGCGGGAGGAACCAGCGGTCCCCGGTG
GGGCGGGGGGCCCGGACACTCGGGGGGCCGGCGGCGGCGGCGACTCTGGACGCGAGCCGG
GCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGG
CGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGCTCCACCCCCCCATCGCCTCTCC
CGAGGTGCGTGGCGGGGGCGGGCGGGCGTGTCCCGCGCGTGTGGGGGGAACCTCCGCGTC
GGTGTTCCCCCGCCGGGTCCGCCCCCCGGGCCGCGGTTTTCCGCGCGGCGCCCCCGCCTC
GGCCGGCGCCTAGCAGCCGACTTAGAACTGGTGCGGACCAGGGGAATCCGACTGTTTAAT
TAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGACGCGATGTGATTTCTGCCCAGT
GCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAACGGCGGGAGTAACTAT
GACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGAATGGATGA
ACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCCAAGGGAACGGGCTT
GGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCTGGCACGGTGAAG
AGACATGAGAGGTGTAGAATAAGTGGGAGGCCCCCGGCGCCCGGCCCCGTCCTCGCGTCG
GGGTCGGGGCACGCCGGCCTCGCGGGCCGCCGGTGAAATACCACTACTCTCATCGTTTTT
TCACTGACCCGGTGAGGCGGGGGGGCGAGCCCCGAGGGGCTCTCGCTTCTGGCGCCAAGC
GTCCGTCCCGCGCGTGCGGGCGGGCGCGACCCGCTCCGGGGACAGTGCCAGGTGGGGAGT
TTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAGGGA
GGACAGAAACCTCCCGTGGAGCAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTCAGTAC
GAATACAGACCGTGAAAGCGGGGCCTCACGATCCTTCTGACCTTTTGGGTTTTAAGCAGG
AGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAGCGA
CGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAA
GCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGAGACA
GGTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAG
GAACCGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCT
ACCATCTGTGGGATTATGACTGAACGCCTCTAAGTCAGAATCCCGCCCAGGCGGAACGAT
ACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGC
TCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGGTCTCCCCCCGCCGGGCGTCGG
GACCGGGGTCCGGTGCGGAGAGCCGTTCGTCTTGGGAAACGGGGTGCGGCCGGAAAGGGG
GCCGCCCTCTCGCCCGTCACGTTGAACGCACGTTCGTGTGGAACCTGGCGCTAAACCATT
CGTAGACGACCTGCTTCTGGGTCGGGGTTTCGTACGTAGCAGAGCAGCTCCCTCGCTGCG
ATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGTCTCTGCGGGCTTTC
SNORA7 H/ACA
SNORA7 H/ACA
SNORD32 18S:G1328, 28S:A1337 C/D
SNORA8 18S:U1057,18S:U1082,28S:U3509 H/ACA
SNORA8 18S:U1057,18S:U1082,28S:U3509 H/ACA
SNORA31 18S:U220,28S:U3390 H/ACA
SNORA31 18S:U220,28S:U3390 H/ACA
SNORA58 18S:U3500 H/ACA
SNORA58 18S:U3500 H/ACA
snoMBII-202 18S:U429,28S:A2256 C/D
SNORD18 28S:A1140 C/D
SNORD18 28S:A1140 C/D
SNORD18 28S:A1140 C/D
SNORD51 28S:A1337 C/D
snosnR60_Z15 28S:A1347,28S:G1437 C/D
SNORD38 28S:A1673 C/D
SNORD38 28S:A1673 C/D
SNORD38 28S:A1673 C/D
SNORD24 28S:A2118 C/D
SNORD99 28S:A2540 C/D
SNORD95 28S:A2568 C/D
SNORD95 28S:A2568, 28S:C2577 C/D
SNORD37 28S:A3374 C/D
SNORD36 28S:A3379 C/D
SNORD46 28S:A3416 C/D
SNORD15 28S:A3441 C/D
SNORD15 28S:A3441 C/D
SNORD30 28S:A3481 C/D
SNORD30 28S:A3481 C/D
SNORD79 28S:A3486 C/D
SNORD92 28S:A3523 C/D
SNORD26 28S:A397 C/D
SNORD81 28S:A399 C/D
SNORD81 28S:A399 C/D
SNORD29 28S:A4175 C/D
SNORD63 28S:A4223 C/D
SNORND104 28S:C1154 C/D
SNORD48 28S:C2047 C/D
SNORD24 28S:C2120, 28S:C2106 C/D
SNORD55 28S:C2557 C/D
SNORD95 28S:C2577, 28S:A2568 C/D
SNORD50 28S:C2614 C/D
SNORD50 28S:C2614 C/D
SNORD50 28S:C2614 C/D
SNORD50 28S:C2614 C/D
SNORD50 28S:C2614 C/D
SNORD88 28S:C3357 C/D
SNORD88 28S:C3357 C/D
SNORD88 28S:C3357 C/D
SNORD88 28S:C3357 C/D
SNORD74 28S:C3497 C/D
SNORD53 28S:C3525 C/D
SNORD53 28S:C3525 C/D
SNORD75 28S:C3704 C/D
SNORD47 28S:C3843 C/D
SNORD49 28S:C4108 C/D
SNORD49 28S:C4108 C/D
SNORD35 28S:C4188 C/D
SNORD35 28S:C4188 C/D
SNORD21 28S:G1130 C/D
SNORD73 28S:G1562 C/D
SNORD73 28S:G1762 C/D
snoZ40 28S:G2479 C/D
SNORD87 28S:G3400 C/D
SNORD12 28S:G3554 C/D
SNORD12 28S:G3555 C/D
SNORD12 28S:G3555 C/D
SNORD12 28S:G3555 C/D
SNORD111 28S:G3600 C/D
SNORD111 28S:G3600 C/D
SNORD102 28S:G3692 C/D
SNORD31 28S:G3847 C/D
SNORD60 28S:G4022 C/D
snR38-4 28S:G4044 C/D
snR38-1 28S:G4044 C/D
snR38-2 28S:G4044 C/D
snR38-3 28S:G4044 C/D
SNORD69 28S:G4146 C/D
SNORD91 28S:G4270 C/D
SNORD91 28S:G4270 C/D
SNORD78 28S:G4275 C/D
SNORA7 28S:U1395,28S:U1594 H/ACA
SNORA9 28S:U1496,28S:U1584 H/ACA
SNORA9 28S:U1496,28S:U1584 H/ACA
SNORA9 28S:U1496,28S:U1584 H/ACA
SNORA9 28S:U1496,28S:U1584 H/ACA
SNORA52 28S:U1546 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA32 28S:U1662 H/ACA
SNORA61 28S:U2263 H/ACA
SNORA61 28S:U2263 H/ACA
SNORA61 28S:U2263 H/ACA
SNORA61 28S:U2263 H/ACA
SNORA61 28S:U2263 H/ACA
SNORD34 28S:U2590 C/D
SNORA27 28S:U3371,28S:U4204 H/ACA
SNORA19 28S:U3386,28S:U3295,18S:U864 H/ACA
SNORA19 28S:U3386,28S:U3295,18S:U864 H/ACA
SNORA19 28S:U3386,28S:U3295,18S:U864 H/ACA
SNORA74 28S:U3418,28S:U3420 H/ACA
SNORA74 28S:U3418,28S:U3420,U3:U8 H/ACA
SNORD17 28S:U3474 C/D
SNORA54 28S:U3478,28S:U4221 H/ACA
SNORA62 28S:U3509 H/ACA
SNORA3 28S:U3576 H/ACA
SNORA3 28S:U3576,28S:U3615 H/ACA
SNORA3 28S:U3576,28S:U3615 H/ACA
SNORA3 28S:U3576,28S:U3615 H/ACA
SNORA3 28S:U3576,28S:U3615 H/ACA
SNORD52 28S:U3581 C/D
SNORD52 28S:U3581 C/D
SNORD41 28S:U3858 C/D
SNORD58 28S:U3879, 28S:G3880 C/D
SNORD58 28S:U3879,28S:G3880 C/D
SNORD58 28S:U3879,28S:G3880 C/D
SNORD58 28S:U3879,28S:G3880 C/D
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA2 28S:U3945,28S:U3964 H/ACA
SNORA23 28S:U4013,28S:U3414 H/ACA
SNORA65 28S:U4055,28S:U4109 H/ACA
SNORA65 28S:U4055,28S:U4109 H/ACA
SNORA65 28S:U4055,28S:U4109 H/ACA
SNORA65 28S:U4055,28S:U4109 H/ACA
SNORA65 28S:U4055,28S:U4109 H/ACA
SNORA65 28S:U4055,28S:U4109 H/ACA
SNORA63 28S:U4072 H/ACA
SNORA63 28S:U4072 H/ACA
SNORA63 28S:U4072 H/ACA
SNORA63 28S:U4072 H/ACA
SNORA68 28S:U4075 H/ACA
SNORA68 28S:U4075 H/ACA
SNORA68 28S:U4075 H/ACA
SNORA21 28S:U4083,28SU4152 H/ACA
SNORA21 28S:U4083,28SU4152 H/ACA
SNORA21 28S:U4083,28SU4152 H/ACA
SNORA16 28S:U4094 H/ACA
SNORA16 28S:U4094 H/ACA
SNORA26 28S:U4204 H/ACA
SNORA26 28S:U4204 H/ACA
SNORA26 28S:U4204 H/ACA
SNORA26 28S:U4204 H/ACA
SNORA26 28S:U4204 H/ACA
SNORA40 28S:U4228,18S:U1175 H/ACA
SNORA40 28S:U4228,18S:U1175 H/ACA
SNORA40 28S:U4228,18S:U1175 H/ACA
SNORA40 28S:U4228,18S:U1175 H/ACA
SNORD72 28S:U4272 C/D
SNORA30 28S:U4325 H/ACA
SNORA30 28S:U4325 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA17 28S:U4341,28S:U4280,28S:U4619 H/ACA
SNORA1 28S:U4423 H/ACA
SNORA43 28S:U4620 H/ACA
SNORA43 28S:U4620 H/ACA
SNORA25 28S:U4648 H/ACA
SNORA33 28S:U4648 H/ACA
SNORA33 28S:U4648 H/ACA
SNORA33 28S:U4648 H/ACA
SNORA33 28S:U4648 H/ACA
SNORA22 28S:U4648,28S:U4657 H/ACA
SNORA64 28S:U4657 H/ACA
SNORA62 28SU:3507,28S:U3509 H/ACA
SNORA62 28SU:3507,28S:U3509 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved