snOPY snoRNA Orthological Gene Database
Mus_musculus
5.8S rRNA
NR_003280
158
CGACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCGCTAGCTGCG
AGAATTAATGTGAATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCC
CGGGTTCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT
SNORD96 5.8S:G77 C/D
SNORD71 5.8S:U14 C/D
SNORA72 5.8S:U57 H/ACA
SNORA72 5.8S:U57 H/ACA
SNORA69 5.8S:U71 H/ACA
SNORA69 5.8S:U71 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved