snOPY snoRNA Orthological Gene Database
Mus_musculus
5.8S rRNA
NR_003280
158
CGACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCGCTAGCTGCG
AGAATTAATGTGAATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCC
CGGGTTCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved