snOPY snoRNA Orthological Gene Database
Monodelphis_domestica
28S rRNA
5055
GCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCAGCGGAGGAAA
AGAAACTAACCAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAAGAGCCCAGCGCCGAA
TCCCCGCCCCGCGGTGGGGCGCGGGCCATGTGGCGTACGGAAGACCCACTCCCCGGTGCC
GCTCTCCGGTGGGGGCCCAAGTCCTTCTGATCGAGGCACAGCCCGTGGACGGTGTGAGGC
CGGTAGCGGCCCCCGGGCGCGCCGGGACCGGGTCTTCTCGGAGTCGGGTTGCTTGGGAAT
GCAGCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGT
CAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTTGAAGAGAGAGTTCAAGAGGGGCG
TGAAACCGTTTGAGAGGTAAACGGGTGGGGTCCCGCGCAGTCCGCCCGGAGGATTCAACC
CGGCGGTCCCTGGCCCGGCCGTGCCGGGTTGGTTTCCGGCGGATCTTTCCCGCCCCTCGT
TCTTCCCGACCCCTCCACCCGTCGCCCCGCGAGGGGCGGTGGGCGGGGCCGGGGGTGAGG
TGCCGCGGGGGACCGCCCCCCGGACGGAGCCCGGCCGCCGCCGGGCGCATTTCCACCGAG
GCGGTGCGCCGCGACCGTCTCCGGGACGGCTGGGAAGGCCGGGCTTTTCCCTGGGCAGGT
GGCTCGGGGGTGGCGGGGGCCAGAGGGGGCCCGGGTCGCCGTGTGGGGTGGCGGGGTCGG
TCGGTCCGCCGGCCGGCCTCGTCTTCTCCTCGGCGCCCGCCTCTCGTGGGTCCTCCGCCG
TCGCAGCCCCCGAGTGTTATAGCCCCCCGGCAGTAGCTCTCGCCGCATCCCGGGGTCGAG
GAAGATGACCGCCGCCGCGCTTTCCCCCGCCGGGCCCCTCCGCCGCCCGGTCGCCCGCCC
CTCGCGGGTGGGGGCGGGTGCGCCGGTGCGGGCCCGGGTTCCCGGGGGACGGGCCGCCCC
TTCCCCCGGCGCGACTGCTCTCCCCGAAACCGGGGCGGACTGTCCTCAGTGCGCCCCGAC
CGCGTCGCGCCGCCGGGCTCGGGGACCGCTGCTCTCGTCGCACGAAGGCGCCCGGGGTCA
GCGGCGATGTCGGCCCCCCACCCGACCCGTCTTGAAACACGGACCCAAGGAGTCTAACAC
GCGCGCGAGTCAGGGGCTCGCACGAAAGCCACCCGTGGCGCAATGAAGGTGAAAGGCCGG
CGCCCGCCAGGCCGAAGGTGGGATCCCGAGGCCTCGGTCCTTCTTCCCGTCCTGCCGAGG
GCGCACCACCGGCCCGTCTCGCCCGCCCCGCCGGGGAGGTGGAGCATGAGCGTGTGTGTT
AGGACCCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGG
AGGTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGGCGAAAGA
CTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCGCTC
TTGCAGTGGTCGTCCGGTCGGGCGGGGGGCCTCCCCTCCTTCGGGGGGCGGGGGTTCCCC
TGGCACCCGCCGCCACGCAGTTTTATCCGGTCAAGCGAATGATTAGAGGTCTTGGGGCCG
AAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCTTGG
AGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGC
GGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAGAAAA
GGTGTTGGTTGATATAGACAGCAGGACGGTGGCCATGGAAAGTCGGAATCCGCTAAGGAG
TGTGTAACAACTCACACTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTC
GGGCCCATACCCGGCCGTCGCTGGCAATGGGCAAAAGCAGGAACAGAAACGTGTTGTTTC
CCGAGAACGGATTCCGCGGCGCGGGAGGAAGGCGCGAACTCACTCCTCGGGGGCTAGGCC
GCGACGAGTAGGAGGGCCGCCGCGGTGGGCCTGGAAGCCTAGGGCGTGAGGCCCAGGGTG
GAGCCGCCGCGGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAG
GCCGAAAGTGGAGAAGGGTTCCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTG
AGAGATAGGCGAGCGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCGGCCGAT
CGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGACGGGCGCCGTGAGGC
GTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCT
CTTTTCTTTGTGAAGGGCAGGGCCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGC
GCCTTGGAAAGCGTCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAAT
CCGGGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAA
GGTGAACAGCCTCTGGCATGTTGGAACAATGTAGGTAAGGGAAGTCGGCAAGCCGGATCC
GTAACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCG
GGGCTGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCTCCCCCTCCCGGCGCTCTCCC
GCCGGACGCCTCCCCGTGGCCCCCCCGCCCGCTCCCCGCCGGGTTCCCTTCCCCGCGGCT
CCCCTGGCCTCCCCCCTCCCACACCTCTCCGCCGGCCAAACCGCGGCGGTGGCGGGCGGG
GGAGAACGGGGCGGGCGCGCGGGGGGTTGGGGGCGCGGGTCCCGCCCGCGTCTCCCCTCC
CTCCCGCCCCCCCTCGCTCCTCTCCCACCCCCCCCACCGCGGCGGTGGGGGGCAGGGGGG
GGATCGGCGCCAGGGGGTTCCAAGTCGCGGGGTCGGCCCGGCGGGGGTTGGTCGGTGCGG
TCGGGGTCCGGGGTTCGGGCCCGGCGGGTGCCCGGGACCCGGGGGTCGGCGGCGGCGGCG
ACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCCCAGCTGCGGCGGGCGTCGCGGC
CGGGCCCGGGGAGCCCGGGGGCGGGCCTGCTCGGCCCGCCGGCCTCGGGGGGTCTCCCCT
GGGGCGCGCGTGGCTCCCCGCCCGCGGCCCCCCTCCGGGCCTCCGCGGCGGCGGCGGTCG
GGCCGGCGCGGCGGCGGGTGGGGTTCGCCCCCCTCCGTCCCGCCCGGTTCCCCGGCTCCT
CGCCCGGAGGGCCCCCGGAGCCGGGGGTGTCGGCGGCGGGGTGGGTCCGCGCGCCCCGGG
GCCCCCCGGCCGCGGGATCTGTGGCGGCCCTCCCCCCCCGGGTGCCCCCCCGGGCCCCGG
TCCCCGCGGCGTCCCGCCTCGGCCGGCGCCTAGCAGCTGACTTAGAACTGGTGCGGACCA
GGGGAATCCGACTGTTTAATTAAAACAAAGCATCGCGAGGGCCCGCGGCGGGTGTTGACG
CGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGG
TAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAG
TGACGCGCATGAATGGATGAACGAGATTCCCACTGTCCCTACCTACTATCTAGCGAAACC
ACAGCCAAGGGAACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGAC
TCTAGTCTGGCACGGTGAAGAGACATGAGAGGTGTAGAATAAGTGGGAGGCCCCCGGTGC
CCCCCGGGGCCCCGCCCCCGGGCTCCCCGCGAGGGGATCCCCCGGGTCGGCGGGCCCCCC
CCGGGGTCGGCGAGCCGGCCTTCCGGGCCGCCGGTGAAATACCACTACTCTGATCGTTTT
TTCACTGACCCGGTGAGGCGGGGGGGCGAGCCCCGAGGGGCTCTCGCTTCTGGCGCCAAG
CGCCCGGCCGCACGGCGCGCCGGGCGCGACCCGCTCCGGGGACAGTGTCAGGTGGGGAGT
TTGACTGGGGCGGTACACCTGTCAAACCGTAACGCAGGTGTCCTAAGGCGAGCTCAGGGA
GGACAGAAACCTCCCGTGGGAGCAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTCAGTA
TGAATACAGACCGTGAAAAGCGGGGCCTCACGATCCTTCTGACCTTTGGGGTTTTAAGCA
GGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAGC
GACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACC
AAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGAGA
CAGGTTAGTTTTACCCTACTGATGAGGGGTTGTCGCCATAGTAATCCCTGCTCAGTACGA
GAGGAACCGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAAGGAGCCAATGGGGCGA
AGCTACCATCTGTGGGATTATGACTGAACGCCTCTAAGTCAGAATCCCCCCTAAGCGTGA
CGATACCGCAGCGCCGAGGAGCCTCGGTGGGCCACGGATAGCCGGGCTGCCCGTGCTCCC
TCCCTCCGTTTCGGCGGGGGGGCCTCGGGGGCCGGGGCTCCGGTGCGGAAGGGCCGTTCG
CGCCCGGGGGCTGGAGAAGCGGCCGCGAAGGGGGGCCCGCCTCTCACCTCGGAGCGCAGC
GCATGGTTCGTGGGGCACCTGGTGCTAAATCATTCGTAAGACGAACCTGCTTTCTGGGTC
GGGGTTTCGTGCGTAGCAGAGCAGCTCCCTCGCTGCGATCTATTGAAAGTCAGGCCCTTG
ACACAAGCTTTTGTC
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved