snOPY snoRNA Orthological Gene Database
Microcebus_murinus
28S rRNA
ABDC01566640, ABDC01584483, ABDC01595868
2458
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ccccgtcccctccccgccgccgtccgtcccctccctctctccggagagtcgggggcgggt
gcgcggtgggcgggggggcgggcccagcccccgagtgttacagccccccggcagcagcgc
tcgccgaatcccggggccgaggaagcgagacccgtcgccgcgctctcccccctgccggcg
cccacccgcgcgggggctcccccgcgagggggctccccccgcgcgggcgcgccggtgact
ctcggggggccgggccgcccctcccacggcgcgaccgctcccccaccccctccgcgctcc
ctccggccctccctcccggggggcgtcgggggggccccgcgcgggcgggggcggggcgga
ctgtccccagtgcgccccgggcgggtcgcgccgtcgggcccggggggttttttctctcca
ggggccacgccggagcttttttttttttttaaaaaaaaaagaaagccgaaagcgagcgca
cggggtcggcggcgacgtcggctacccacccgacccgtcttgaaacacggaccaaggagt
ctaacacgtgcgcgagtcaggggctcgcacgaaagccgccgtggcgcaatgaaggtgaag
gccggcgccgctcgccggccgaggtgggatcccgaggcctctccagtccgccgagggcgc
accaccggcccgtctcgcccgccgcgccggggaggtggagcacgagcgcacgtgttagga
cccgaaagatggtgaactatgcctgggcagggcgaagccagaggaaactctggtggaggt
ccgtagcggtcctgacgtgcaaatcggtcgtccgacctgggtataggggcgaaagactaa
tcgaaccatctagtagctggttccctccgaagtttccctcaggatagctggcgctctcgc
agacccccgcagttttatccggtaaagcgaatgattagaggtcttggggccgaaacgatc
tcaacctattctcaaactttaaatgggtaagaagcccggctcgctggcgtggagccgggc
gtggaatgcgagtgcctagtgggccacttttggtaagcagaactggcgctgcgggatgaa
ccgaacgccgggttaaggcgcccgatgccgacgctcatcagaccccagaaaaggtgttgg
ttgatatagacagcaggacggtggccatggaagtcggaatccgctaaggagtgtgtaaca
actcacctgccgaatcaactagccctgaaaatggatggcgctggagcgtcgggcccatac
ccggccgtcgccggcagtcgggagtggacgggagcggcgggcgggccgtccgtccccgcg
cccctcccccgccccctctcttctctcacgggggggggagggcggagaagggcccgcggg
ggcggcgccgccccgagccccgcggacgctacgccgcgacgagtaggagggccgctgcgg
tgagccttgaagcctagggcgcgggcccgggtggagccgccgcaggtgcagatcttggtg
gtagtagcaaatattcaaacgagaactttgaaggccgaagtggagaagggttccatgtga
acagcagttgaacatgggtcagtcggtcctgagagatgggcgagcgccgttccgaaggga
cgggcgatggcctccgttgccctcagccgatcgaaagggagtcgggttcagatccccgaa
tccggagtggcggagatgggcgccgcgaggcgtccagtgcggtaacgcgaccgatcccgg
agaagccggcgggagccccggggagagttctcttttctttgtgaagggcagggcgccctg
gaatgggttcgccccgagagaggggcccgtgccttggaaagcgtcgcggttccggcggcg
tccggtgagctctcgctggcccttgaaaatccgggggagagggtgtaaatctcgcgccgg
gccgtacccatatccgcagcaggtctccaaggtgaacagcctctggcatgttggaacaat
gtaggtaagggaagtcggcaagccggatccgtaacttcgggataaggattggctctaagg
gctgggtcggtcgggctggggcgcgaagcggggctgggcgcgcgccgcggctggacgagg
ccgccgccccccccacgcccggggcacccctccgcggccctcccccgcgcggctcccgga
acttccctccgccgccggtcggtcgcggccccccccctcgctcgctcgcgcgcccgctcc
cctcttccccaccgccccctctccctctctcctccccgcccccaccgtccccccgcgcgg
tctcccccacccctcccggggtcgcggggcgggccgtcgggtgcggcgcggtcggggcnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved