snOPY snoRNA Orthological Gene Database
Microcebus_murinus
5.8S rRNA
ABDC01332884
157
CGACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCTAGCTGCGAG
AATTAATGTGAATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCCCG
GGTTCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCTT
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved