snOPY snoRNA Orthological Gene Database
Macaca_mulatta
18S rRNA
FJ436026
1867
tacctggttgatcctgccagtagcatatgattgtctcaacgattaagccatgcatgtcta
agtaggaacggccggtacagtgaaactgcgaatggctcattaaatcagttatggttcctt
tggtcgctcgctcctctcctacttggataactgtggtaattctagagctaatacatgccg
acgggcgctgacccccttcgcgggggggatgcgtgcatttatcagatcaaaaccaacccg
gtcagcccctctccggccccggccggggggcgggcgccggcggctttggtgactctagat
aacctcgggccgatcgcacgccccccgtggcggcgacgacccattcgaacgtctgcccta
tcaactttcgatggtagtcgccgtgcctaccatggtgaccacgggtgacggggaatcagg
gttcgattccggagagggagcctgagaaacggctaccacatccaaggaaggcagcaggcg
cgcaaattacccactcccgacccggggaggtagtgacgaaaaataacaatacaggactct
ttcgaggccctgtaattggaatgagtccactttaaatcctttaacgaggatccattggag
ggcaagtctggtgccagcagccgcggtaattccagctccaatagcgtatattaaagttgc
tgcagttaaaaagctcgtagttggatcttgggagtgggcgggtggtctgccacgaggcga
gccaccgcttgtccccaccccttgcctcttggcgccccctcgatgctcttagctgagtgt
cccgtggggcccgaagcgtttactttgaaaaaattagtgttcaaagcaggcccgagccgc
ctgaataccgcagctaggaataatggaataggaccgtggtcctattttgttggttttcgg
aactgaggccatgattaagaggaacggatgggggcattcgtattgcgacgttagaggtga
aattcttggatcgtcgcaagacggacagaagcgaaagcatttgccaaaaacgctttcatt
gatcaagaacgaaagttagaggttcgaaggcgatcagataccgccctagttctaaccata
aacgatgccagctagcgatccgccgacgttcctccgatgactcggcgggcagcttccggg
aaaccaaagcttttgggttccgggggaagtatggttgcaaagctgaaacttaaaggaatt
gacggaagggcaccaccaggagtggagcctgcggcttaatttgactcaacacgggaaacc
tcaccaggcccggacaccggaaggattgacagattgagagctctttcttgattcggtggg
tggtggtgcatggccgttcttagttggtggagcgatttgtctggttaattccgataacga
acgagactctggcatgctaactagttacgcgacccccgagcggtcggcgtcccccaactt
cttagagggacaagtggcgttcagccacccgagattgagcaataacaggtctgtgatgcc
cttagatgtccggggctgcacgcgcgctacactgactggctcagcgtgtgcctaccctac
gccggcaggcgcgggtaacccgttgaaccccattcgtgatggggatcggggattgcaatt
attccccatgaacgaggaattcccagtaagtgcgggtcataagcttgcgttgattaagtc
cctgccctttgtacacaccgcccgtcgctactaccgattggatggtttagtgaggccctc
ggatcggccccgccggggtcggcccacggccctggcggagcgctgagaagacggtcgaac
ttgactatctagaggaagtaaaagtcgtaacaaggtttccgtaggtgaacctgcggaagg
atcatta
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved