snOPY snoRNA Orthological Gene Database
Macaca_mulatta
28S rRNA
AANU01094733
4184
catgacctcaggctagacgtggcaacctgctgaatttaagcatattagtcagtggagaaa
atggaactaaccaggatgcccttagtaaaggtaagtgaacaggcatcccagtgccaaatc
cctgccccttggtggggtgagggaaatgtggcgcatggaagactcactcaccagtgccac
ttgttggggcccaagtcctgattgaggcagccagcctgtggaaggtgtgaggccattagc
agcccctggctgccaggcctgggtcttcccagagccgggttgctgggaatgcaacctcaa
gctggtggcaaactctatctaaggttaaatactgcaggagaccgcaataatcaacaagta
ctgtaagggaaagttgaaaagaactttgaagacgcagttcaagagggcatgaaaccatta
acacttacatgggtggggtccctgcagtctgatggaggatgcaaaccggcggtgggtcag
gctgtgccagtgatctggcggatctttcctgccttcagtttctcctgacccctccaattg
ccttccctccccggtaacccctcctcctcctgggaggccccagtgcgtgcaggggtgggc
ccggggtcggggagagcggactgtcccccagccggggaatggctgcctctgggtgtattt
ccactgtgatgctgccccgtgactgtctctgggaagatgggaagacccgacagtgaaggt
ggctcagggaggccctgtcctccctgtccctcaggaggggtgtggggtggatcctccccc
cgagtgtttcaccccccagcagtagcactccccgaatcccggggctgaaggagtgagacc
cgttaccgtgttctccgcctcctggcgcccaccccagtggggcccccctatgaggaggtc
gcccgtaggggcataacagcatgcctctaggggactgggccacctctcccacggtgtaac
tgctctcctaccccctccctgccccaagcgagtaggctgcatgggagggtctgggactca
ctgtgatgtgctccaggcgggttgtgctgtcgggcctggggggtctcttaaagccaggca
ctcatttcaaaagaacagtggaactagtgcacaaggtaggtggtgctgtcggtnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctttcgcccactgc
gctgggcgggtggagcatgaatgcatgtgttaggcaccaaaagatgataaactatgcctg
ggcagggcgaagccagaggaaactctcgtgggggtctgtagtggtcctgacatgcaagtc
ggtcgtctgatctgggtataggggcaaaagactaatggaactatctagtagctggttccc
tctgaagttttcctaaggatagctagtgctctcgcaaaaaccccatgccatgcagttatt
tggtaaagcgaatgatttggggtcttggagtcgaaatgatctcaaccaattctcaaactt
taaatgggttagaagaccagctcaatggtgtggagccagatacggaatgtgagtgcctag
tgggcaacttttggtaagcagaactgatgctgtgggatgaacgaaatgccatgttaaggt
gcctgattctgatgcccattagaccccagaaaatgtgctggttgatatagagagcaggac
ggtgggcatggaagtcagaatccgctaaggagtgtttaacaacaacaaatcaactagccc
tgaaaaacggatggtactgaaacattgggcccatacccggctgttgccagcagttgagag
tggatgggagtggtgagggtggtcacccccgctggagccctgtggatgctgggagggctg
ctgcggtgagccctgaagccttggacgtgagcctgggtggagctgctccagatgcagatc
ttggtggtagtagcaaatattaaaatgagaactttgaaggccgaagtggagaagggttcc
agttgaacgtgggtcacttgctcctgagacatgggcaagtaccattccgaagggatggat
gatgacttccattgcccccggctgatggaaagggagtcaagttcagatttctgaatccgg
agtgacagagatgggcactatgaggcattcagggaggtaatggaactgattctggagaaa
ctggtgggagcccaggggagagctctttttgtgaagagcagggcgccctgtaatggattc
acccttagacaggggcctgtgccttggaaagaatcacagttcaagtggcatctggtgagc
tctcacaggcccttgaaaatctaggagagagggtgtaaatctcacactgggctgtaacca
tatccacagcaggtctccaaggtaaacaacctctggcatgttagaacaacataggtaagg
gaaatcagcaagctagatcagtaacctcagggtaagaatttgctctaagagctttgccag
tccggctgcggcttgaagcggggctgggtgcaggcattggttggatgaagtgctggtact
ccacgccccaacgctagcagcacccctctgcagacatcccccagcccacctcgccatacc
ttcctcttcactatccctccctacctcactattgctggttcctggcggcccatttagaaa
tgatgcagaccacgggaatctgactatataaaacaaagcatggtgaaggcccgtggtggg
tgttgacacaatgtcaattctacccagtgctctgaatgtcaaagtgaagaaattcaatga
agcacgagtaaatggcgggagtaactatgtctctcttaagtgtagccaaatgcctcatca
tctaattagtgatgcacatgaatggatgggcaagattcccactgttcttacctgctatcc
agcgaaaccacagccaaaggaatgggcttgacagaatcagcagggaacgaagaccctatt
gagactgactctagtctggcacgatgaagagacatgagaggtgtagaataagtgaaagac
ccctgcacccctctgtttctctgaggagatggggtgaggtccactgaccttgtgggctgc
cagtgaaatcccactaccctgatcattttttcactgacctggtgaagttggggctgggta
ggtgagccacaaggggcccacacttttggcaccaagcacctggccacatgctggctggat
gttaactgctccaggaatagtgccaggtgcagagttggactggtgctgcacacctgtcaa
acggtaatgcaggtgtctgaaggtgagtgcagggagtaccaaaacctcccatggagcaga
agggcagaagttgcttgatcttgattttcagtacgaaagcagggcctcatgatccttttg
atgttttgtttgagttttaagcaggacgtgtcagagaagacaccacagggataactgcct
tgtagtggccaagagttcatagcaacattgctttttgatcctttggtgctggatcttcct
attgtgaagcagaattcaccaagcattggattgttcacccactaataggaaacgtgagct
gggtttagaccgtcgtgagacaggttagttttaccctactgatgatgtgttgttgccatg
gtaatcctgctcagtacgagaggaaaccgcaggttcagacatttggtgtatgtgcttggc
tgaggagccaatggggcgaagctaccatctgtgggattatgactgaacgcctctaagtca
gaatcccgcccaggcggaacgatacggcagcgccgcggagcctcggttggcctcggatag
ccggtcccccgcctgtccccgccggcgggccgcctcgccccgcgcggggcgtgccccgcc
gcgcgccgggaccggggtccggtgcggagtgcccttcgtcctgggaaacggggtgcggcc
ggaaaggcggccgccccctcgcccgtcacgcaacgcacgttcgtggggaacctggcgcta
aaccattcgtagacgacctgcttctgggtcggggtttcgtacgtagcagagcagctccct
cgctgcgatctattgaaagtcagccctcgacacaagggtttgtc
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved