snOPY snoRNA Orthological Gene Database
Loxodonta_africana
28S rRNA
1060
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCGCGCGTCGGCCGGCCGGCGGGGGCGCGACCCATCCGGGGACAGTGCCAGGTGGGGAGT
TTGACTGGGGCGGTACACCTGTCAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAGGGAG
GACAGAAACCTCCGTGGAGCAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTCAGTACGA
ATACAGACCGTGAAAGCGGGGCCTCACGATCCTTCTGACCTTTGGGGTTTTAAGCAGGAG
GTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAGCGACG
TCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGC
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGAGACAGG
TTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGA
ACCGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCAATGGGCGAAGCTACC
ATCTGTGGGATTATGACTGAACGCCTCTAAGTCAGAATCCCGCCCAGGAGGAACGATACG
GCAGCGCCGCGGAGCCTCGGTTGGCCTCGGATAGCCGGCGCCCCGCCGTCCCCGCCGGCG
GGCCCGTCGCTCGCGCGTGCGCTCGCGTGCGCGCGGGCGGCGCGGCCCCGCCGCGCGCCG
GGACCGGGGTCCGGTGCGGAGCGCCCTCCGTCCCGGGAGAAGACGGGGCGCGGCCGGAAA
GGCGGCCGCCCCCTCGCCCGTCACGCACCGCACGTTCGTGGGGAGCCTGGCGCTAAACCA
TTCGTAGACGACCTGCTTCTGGGTCGGGGTTTCGTACGTAGCAGAGCAGCTCCCTCGCTG
CGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGTCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved