snOPY snoRNA Orthological Gene Database
Homo_sapiens
U12 snRNA
HUMUR12
150
ntgccttaaacttatgagtaaggaaaataacgattcggggtgacgcccgaatcctcactg
ctaatgtgagacgaatttttgagcgggtaaaggtcgccctcaaggtgacccgcctacttt
gcgggatgcctgggagttgcgatctgcccg
SCARNA17 U4:C8,U12:G22 C/D
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved