snOPY snoRNA Orthological Gene Database
Homo_sapiens
U5 snRNA
116
ATACTCTGGTTTCTCTTCAGATCGCATAAATCTTTCGCCTTTTACTAAAGATTTCCGTGG
AGAGGAACAACTCTGAGTCTTAACCCAATTTTTTGAGCCTTGCTCCGACAAGGCTA
SCARNA13 U2:U54,U5:U53 H/ACA
SCARNA6 U5:U41 C/D
SCARNA5 U5:U41,U4:A65 C/D
SCARNA11 U5:U43 H/ACA
SCARNA12 U5:U46 H/ACA
SCARNA10 U5:U46,U5:C45 H/ACA,C/D
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved