snOPY snoRNA Orthological Gene Database
Homo_sapiens
U2 snRNA
NR_002716
188
ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATAT
CTGATACGTCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGA
ATAGGAGCTTGCTCCGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCCAGGAACG
GTGCACCA
SCARNA2 U2:G11,U2:G25,U2:C61 C/D
SCARNA9 U2:G19,U2:A30 C/D
SCARNA8 U2:U34,U2:U44 H/ACA
SCARNA15 U2:U37 H/ACA
SCARNA4 U2:U39,U2:U41 H/ACA
SCARNA13 U2:U54,U5:U53 H/ACA
SCARNA14 U2:U7 H/ACA
SCARNA1 U2:U89 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved