snOPY snoRNA Orthological Gene Database
Homo_sapiens
U1 snRNA
NR_004421
164
ATACTTACCTGGCAGGGGAGATACCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTT
ATCCATTGCACTCCGGATGTGCTGACCCCTGCGATTTCCCCAAATGTGGGAAACTCGACT
GCATAATTTGTGGTAGTGGGGGACTGCGTTCGCGCTTTCCCCTG
SCARNA7 U1:A70 C/D
SCARNA16 U1:U5 H/ACA
SCARNA18 U1:U6 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved