snOPY snoRNA Orthological Gene Database
Homo_sapiens
U6 snRNA
NR_004394
106
GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGC
CCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT
SNORD10 U6 snRNA:C77,28S:C3787 unknown
SNORD7 U6:A47 C/D
SNORD9 U6:A53 C/D
SNORD8 U6:A53 C/D
SNORD67 U6:C60 C/D
SNORD94 U6:C62 C/D
SNORA79 U6:U31,U6:U86 H/ACA
SCARNA23 U6:U40 H/ACA
SCARNA3 U6:U40 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved