snOPY snoRNA Orthological Gene Database
Homo_sapiens
U3 snRNA
216
AAGACTATACTTTCAGGGATCATTTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGT
GTAGAGCACCGAAAACCACGAGGAAGAGAGGTAGCGTTTTCTCCTGAGCGTGAAGCCGGC
TTTCTGGCGTTGCTTGGCTGCAACTGCCGTCAGCCATTGATGATCGTTCTTCTCTCCGTA
TTGGGGAGTGAGAGGGAGAGAACGCGGTCTGAGTGG
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved