snOPY snoRNA Orthological Gene Database
Homo_sapiens
28S rRNA
NR_003287
5035
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCAGCGGAGGAA
AAGAAACTAACCAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAAGAGCCCAGCGCCGA
ATCCCCGCCCCGCGGGGCGCGGGACATGTGGCGTACGGAAGACCCGCTCCCCGGCGCCGC
TCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCAGCCCGTGGACGGTGTGAGGCCGGTA
GCGGCCGGCGCGCGCCCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCAGCCCAAAGC
GGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCAACAAGTACCG
TAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGA
GGTAAACGGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGCGGGTCCGGC
CGTGTCGGCGGCCCGGCGGATCTTTCCCGCCCCCCGTTCCTCCCGACCCCTCCACCCGCC
CTCCCTTCCCCCGCCGCCCCTCCTCCTCCTCCCCGGAGGGGGCGGGCTCCGGCGGGTGCG
GGGGTGGGCGGGCGGGGCCGGGGGTGGGGTCGGCGGGGGACCGTCCCCCGACCGGCGACC
GGCCGCCGCCGGGCGCATTTCCACCGCGGCGGTGCGCCGCGACCGGCTCCGGGACGGCTG
GGAAGGCCCGGCGGGGAAGGTGGCTCGGGGGGCCCCGTCCGTCCGTCCGTCCTCCTCCTC
CCCCGTCTCCGCCCCCCGGCCCCGCGTCCTCCCTCGGGAGGGCGCGCGGGTCGGGGCGGC
GGCGGCGGCGGCGGTGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGTGT
TACAGCCCCCCCGGCAGCAGCACTCGCCGAATCCCGGGGCCGAGGGAGCGAGACCCGTCG
CCGCGCTCTCCCCCCTCCCGGCGCCCACCCCCGCGGGGAATCCCCCGCGAGGGGGGTCTC
CCCCGCGGGGGCGCGCCGGCGTCTCCTCGTGGGGGGGCCGGGCCACCCCTCCCACGGCGC
GACCGCTCTCCCACCCCTCCTCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGTGCCGCGC
GCGGGTCGGGGGGCGGGGCGGACTGTCCCCAGTGCGCCCCGGGCGGGTCGCGCCGTCGGG
CCCGGGGGAGGTTCTCTCGGGGCCACGCGCGCGTCCCCCGAAGAGGGGGACGGCGGAGCG
AGCGCACGGGGTCGGCGGCGACGTCGGCTACCCACCCGACCCGTCTTGAAACACGGACCA
AGGAGTCTAACACGTGCGCGAGTCGGGGGCTCGCACGAAAGCCGCCGTGGCGCAATGAAG
GTGAAGGCCGGCGCGCTCGCCGGCCGAGGTGGGATCCCGAGGCCTCTCCAGTCCGCCGAG
GGCGCACCACCGGCCCGTCTCGCCCGCCGCGCCGGGGAGGTGGAGCACGAGCGCACGTGT
TAGGACCCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTG
GAGGTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGGCGAAAG
ACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCGCT
CTCGCAGACCCGACGCACCCCCGCCACGCAGTTTTATCCGGTAAAGCGAATGATTAGAGG
TCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCT
CGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGA
ACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAG
ACCCCAGAAAAGGTGTTGGTTGATATAGACAGCAGGACGGTGGCCATGGAAGTCGGAATC
CGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGC
TGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAGTCGAGAGTGGACGGGAGCGGCGGG
GGCGGCGCGCGCGCGCGCGCGTGTGGTGTGCGTCGGAGGGCGGCGGCGGCGGCGGCGGCG
GGGGTGTGGGGTCCTTCCCCCGCCCCCCCCCCCACGCCTCCTCCCCTCCTCCCGCCCACG
CCCCGCTCCCCGCCCCCGGAGCCCCGCGGACGCTACGCCGCGACGAGTAGGAGGGCCGCT
GCGGTGAGCCTTGAAGCCTAGGGCGCGGGCCCGGGTGGAGCCGCCGCAGGTGCAGATCTT
GGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCAT
GTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAA
GGGACGGGCGATGGCCTCCGTTGCCCTCGGCCGATCGAAAGGGAGTCGGGTTCAGATCCC
CGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATC
CCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAAGGGCAGGGCGC
CCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGTGCCTTGGAAAGCGTCGCGGTTCCGGC
GGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAATCCGGGGGAGAGGGTGTAAATCTCGCG
CCGGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGTGAACAGCCTCTGGCATGTTGGAA
CAATGTAGGTAAGGGAAGTCGGCAAGCCGGATCCGTAACTTCGGGATAAGGATTGGCTCT
AAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCGGGGCTGGGCGCGCGCCGCGGCTGGAC
GAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCTCGCGGCCCTCCCCCGCCCCACCC
GCGCGCGCCGCTCGCTCCCTCCCCACCCCGCGCCCTCTCTCTCTCTCTCTCCCCCGCTCC
CCGTCCTCCCCCCTCCCCGGGGGAGCGCCGCGTGGGGGCGCGGCGGGGGGAGAAGGGTCG
GGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGTCCCCGCGAGG
GGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACTCTGGACGCGAGCCGGGCCCT
TCCCGTGGATCGCCCCAGCTGCGGCGGGCGTCGCGGCCGCCCCCGGGGAGCCCGGCGGCG
GCGCGGCGCGCCCCCCACCCCCACCCCACGTCTCGGTCGCGCGCGCGTCCGCTGGGGGCG
GGAGCGGTCGGGCGGCGGCGGTCGGCGGGCGGCGGGGCGGGGCGGTTCGTCCCCCCGCCC
TACCCCCCCGGCCCCGTCCGCCCCCCGTTCCCCCCTCCTCCTCGGCGCGCGGCGGCGGCG
GCGGCAGGCGGCGGAGGGGCCGCGGGCCGGTCCCCCCCGCCGGGTCCGCCCCCGGGGCCG
CGGTTCCGCGCGCGCCTCGCCTCGGCCGGCGCCTAGCAGCCGACTTAGAACTGGTGCGGA
CCAGGGGAATCCGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTG
ACGCGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGC
GGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAAT
TAGTGACGCGCATGAATGGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAA
ACCACAGCCAAGGGAACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTT
GACTCTAGTCTGGCACGGTGAAGAGACATGAGAGGTGTAGAATAAGTGGGAGGCCCCCGG
CGCCCCCCCGGTGTCCCCGCGAGGGGCCCGGGGCGGGGTCCGCGGCCCTGCGGGCCGCCG
GTGAAATACCACTACTCTGATCGTTTTTTCACTGACCCGGTGAGGCGGGGGGGCGAGCCC
GAGGGGCTCTCGCTTCTGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCTCCGGGGA
CAGTGCCAGGTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTC
CTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAAAAGCTCGCTT
GATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCACGATCCTTCTGACC
TTTTGGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCG
GCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTG
TGAAGCAGAATTCGCCAAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGT
TTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAA
TCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAGG
AGCCAATGGGGCGAAGCTACCATCTGTGGGATTATGACTGAACGCCTCTAAGTCAGAATC
CCGCCCAGGCGAACGATACGGCAGCGCCGCGGAGCCTCGGTTGGCCTCGGATAGCCGGTC
CCCCGCCTGTCCCCGCCGGCGGGCCGCCCCCCCCTCCACGCGCCCCGCCGCGGGAGGGCG
CGTGCCCCGCCGCGCGCCGGGACCGGGGTCCGGTGCGGAGTGCCCTTCGTCCTGGGAAAC
GGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCCCGTCACGCACCGCACGTTCGTGGGGA
ACCTGGCGCTAAACCATTCGTAGACGACCTGCTTCTGGGTCGGGGTTTCGTACGTAGCAG
AGCAGCTCCCTCGCTGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGTC
SNORA9 28S:U1670,28S:U1769 H/ACA
SNORD32B 18S:G1328,28S:A1511 C/D
SNORD32A 18S:G1328,28S:A1511 C/D
SNORA8 18S:U1056,18S:U1081,28S:U3832 H/ACA
SNORA10 18S:U210,28S:U4491 H/ACA
SNORA31 18S:U218,28S:U3713 H/ACA
SNORD68 18S:U428,28S:A2388 C/D
SNORD18C 28S:A1313 C/D
SNORD18B 28S:A1313 C/D
SNORD18A 28S:A1313 C/D
SNORD51 28S:A1511 C/D
SNORD77 28S:A1521 C/D
SNORD80 28S:A1521,28S:G1612 C/D
SNORD38B 28S:A1858 C/D
SNORD38A 28S:A1858 C/D
SNORD38B 28S:A1858 C/D
SNORD76 28S:A2350 C/D
SNORD99 28S:A2774 C/D
SNORD95 28S:A2802,28S:C2811 C/D
SNORD37 28S:A3697 C/D
SNORD36C 28S:A3703 C/D
SNORD46 28S:A3739 C/D
SNORD15A 28S:A3764 C/D
SNORD15B 28S:A3764 C/D
SNORD30 28S:A3804 C/D
SNORD79 28S:A3809 C/D
SNORD92 28S:A3846 C/D
SNORD26 28S:A389 C/D
SNORD81 28S:A391 C/D
SNORD29 28S:A4493 C/D
SNORD63 28S:A4541 C/D
SNORD119 28S:A4560 C/D
SNORD104 28S:C1327 C/D
SNORD48 28S:C2279 C/D
SNORD24 28S:C2338,28S:C2352 C/D
SNORD5 28S:C2409 C/D
SNORD55 28S:C2791 C/D
SNORD50A 28S:C2848,28S:G2863 C/D
SNORD88B 28S:C3680 C/D
SNORD88A 28S:C3680 C/D
SNORD88C 28S:C3680 C/D
SNORD74 28S:C3820 C/D
SNORD53 28S:C3848 C/D
SNORD47 28S:C3866 C/D
SNORD75 28S:C4032 C/D
SNORD49B 28S:C4426 C/D
SNORD49A 28S:C4426 C/D
SNORD35A 28S:C4506 C/D
SNORD35B 28S:C4506 C/D
SNORD21 28S:G1303 C/D
SNORD2 28S:G1509 C/D
SNORD73A 28S:G1747 C/D
SNORD6 28S:G2411 C/D
SNORD87 28S:G3723 C/D
SNORD12C 28S:G3878 C/D
SNORD12 28S:G3878 C/D
SNORD12B 28S:G3878 C/D
SNORD111B 28S:G3923 C/D
SNORD111 28S:G3923 C/D
SNORD102 28S:G4020 C/D
SNORD31 28S:G4166 C/D
SNORD31 28S:G4166 C/D
SNORD60 28S:G4340 C/D
SNORD1B 28S:G4362 C/D
SNORD1A 28S:G4362 C/D
SNORD1C 28S:G4362 C/D
SNORD69 28S:G4464 C/D
SNORD91B 28S:G4588 C/D
SNORD91A 28S:G4588 C/D
SNORD78 28S:G4593 C/D
SNORA7A 28S:U1569,28S:U1779 H/ACA
SNORA7B 28S:U1569,28S:U1779 H/ACA
SNORA7B 28S:U1569,28S:U1779 H/ACA
SNORA56 28S:U1664 H/ACA
SNORA9 28S:U1670,28S:U1769 H/ACA
SNORA52 28S:U1731 H/ACA
SNORA47 28S:U1766 H/ACA
SNORA32 28S:U1847 H/ACA
SNORA61 28S:U2495 H/ACA
SNORD34 28S:U2824 C/D
SNORA6 28S:U3616 H/ACA
SNORA19 28S:U3618,28S:U3709,18S:U863 H/ACA
SNORA27 28S:U3694,28S:U4522 H/ACA
SNORA23 28S:U3737,28S:U4331 H/ACA
SNORA74B 28S:U3741,28S:U3743 H/ACA
SNORA74A 28S:U3741,28S:U3743,U3:U8 H/ACA
SNORD17 28S:U3797 C/D
SNORA48 28S:U3797 H/ACA
SNORA48 28S:U3797 H/ACA
SNORA54 28S:U3801,28S:U4539 H/ACA
SNORA58 28S:U3823 H/ACA
SNORA58 28S:U3823 H/ACA
SNORA58 28S:U3823 H/ACA
SNORA62 28S:U3830,28S:U3832 H/ACA
SNORA62 28S:U3830,28S:U3832 H/ACA
SNORA45 28S:U3899 H/ACA
SNORA3 28S:U3899,28S:U3938 H/ACA
SNORD52 28S:U3904 C/D
SNORD58C 28S:U4197,28S:G4198 C/D
SNORD58B 28S:U4197,28S:G4198 C/D
SNORD58A 28S:U4197,28S:G4198 C/D
SNORA2A 28S:U4263,28S:U4282 H/ACA
SNORA2B 28S:U4263,28S:U4282 H/ACA
SNORA34 28S:U4269,28S:U4282 H/ACA
SNORD41 28S:U4276 C/D
SNORA78 28S:U4331 H/ACA
SNORA65 28S:U4373,28S:U4427 H/ACA
SNORA63 28S:U4390 H/ACA
SNORA63 28S:U4390 H/ACA
SNORA68 28S:U4393 H/ACA
SNORA68 28S:U4393 H/ACA
SNORA21 28S:U4401,28S:U4470 H/ACA
SNORA16 28S:U4412 H/ACA
SNORA1 28S:U4441 H/ACA
SNORA26 28S:U4522 H/ACA
SNORA26 28S:U4522 H/ACA
SNORA40 28S:U4546,18S:U1174 H/ACA
SNORA40 28S:U4546,18S:U1174 H/ACA
SNORD72 28S:U4590 C/D
SNORA17 28S:U4598,28S:U4659,28S:U4937 H/ACA
SNORA37 28S:U4643 H/ACA
SNORA37 28S:U4643 H/ACA
SNORA30 28S:U4643 H/ACA
SNORA30 28S:U4643 H/ACA
SNORA43 28S:U4938 H/ACA
SNORA33 28S:U4966 H/ACA
SNORA22 28S:U4966,28S:U4975 H/ACA
SNORA22 28S:U4966,28S:U4975 H/ACA
SNORA22 28S:U4966,28S:U4975 H/ACA
SNORA22 28S:U4966,28S:U4975 H/ACA
SNORA64 28S:U4975 H/ACA
SNORA64 28S:U4975 H/ACA
SNORD118 Processing C/D
SNORD118 Processing C/D
SNORD118 Processing C/D
SNORD10 U6 snRNA:C77,28S:C3787 unknown
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved