snOPY snoRNA Orthological Gene Database
Homo_sapiens
5.8S rRNA
U13369
157
cgactcttagcggtggatcactcggctcgtgcgtcgatgaagaacgcagctagctgcgag
aattaatgtgaattgcaggacacattgatcatcgacacttcgaacgcacttgcggccccg
ggttcctcccggggctacgcctgtctgagcgtcgctt
SNORA69 18S:U36,5.8S:U69 H/ACA
SNORD96A 5.8S:G75 C/D
SNORD96B 5.8S:G75 C/D
SNORD71 5.8S:U14 C/D
SNORA72 5.8S:U55 H/ACA
SNORA72 5.8S:U55 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved