snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus
18S rRNA
AANH01010112
1863
TACCTGGTTGATCTCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCAAGTGT
AAGTACACACGGACTGTACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATGGTCCCT
TTGATCGCTCTCACGTTACTTGGATAACTGTGGCAATTCTAGAGCTAATACATGCAAAAC
GAGCGCTGACCCTCCCGGGGGATGCGTGCATTTATCAGATCCAAAACCCATGCGGGGAGC
CCCTCCGGAGGGTGCCCCCGGACCCCTTTGGTGACTCTGGATAACTCTCGAGCCGATCGC
TGGCCCCCCGCGGCGGCGACGTCTCTTTCGAATGTCTGCCCTATCAACTTTCGATGGTAC
TTTCCGTGCCTACTCATGGTGACAACGGGTAACGGGGAATCAGGGTTCGATTCCGGGAGA
GGGAGCCTGAGAAAACGGCTACCACATCCAAGGAAGGTCAGCAGGCGCGGCAAATTACCC
ACTCCCGACTCGGGGGAGGTAGTGACGAAAAATAACAATACAGGACTCTTTCGAGGCCCT
GTAATTGGAATGGGTGCACTTTAAATCCTTTGACGAGGATCCATTGGAGGGACAAGTCTG
GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAACGTTGCTGTAGTTAAA
AAGCTCGTAGTTGGACCTCGGGGTCCGGCTGGCGGTCCGCCGCGAGGCGTGCCACCGCCT
GCCCGGGCCCCTGCCTCTCGGCCGCCCCCGGGATGCTCTTGACTGAGTGTCCCGCCCGGG
GCCCGAAGCGTTTACTTTGAAAAAATCAGAGTGTTCAAAGCAGGCCCGGTCGCCTGAATA
CCGCAGCTAGGAATGATGGAATAGGACTCCGGTCCTATTTTGTGGGTTTTATCCTCCGGA
CTGGAGCCATGATTGAGAGGGACGGCCGGGGGCATTCGTATTGTGCCGCTAGAGGTGAAA
TTCTTGGACCGGCGCAAGACGGACGAGAGCGAAAGCATTTGCCAAGAATGTTTTCATTAA
TCAAGAACGAAAGTCGGAGGTTCGAAGACGATCAGATACCGTCGTAGTTCCGACCATAAA
CGATGCCAACTAGCGATCCGGGCGGCGTTATTCCCATGACCCGCCGGGCAGCGTCCGGGA
AACCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTTGCAAAAGCTGAAACTTAAAGGAATT
GACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAACC
TCACCCGGCCCGGACACGGAAAGGATTGACAGATTGACAGCTCTTTCTCGATTCTGTGGG
TGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGATAACGA
ACGAGACTCCGGCATGCTAACTAGTGGCGCGGCCCCGTGCGGTCGGCGCAAGTACTTCTT
AGAGGGACAAGTGGCGTTCAGCCACACGAGATTGAGCAATAACAGGTCTGTGATGCCCTT
AGATGTCCGGGGCTGCACGCGCGCCACACTGAGTGGCTCATCTGGTGCCTACCCTGCGCT
GACAGACGCGGGTAACCCCCTGAACCCCACTCGTGATAGGGATTGGGGACTGCAACTATT
TCCCATGAACGAGGAATTCCCAGTAAGCGCGGTTCATAAGCTCGCGTTGATTAAGTCCCT
GCCCTTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGCTTAGTGAGGTCCTCGGA
TGGGCCCCGCCGGAGACGGAGACGCCGCCGGGGGAGCGCCCAGAAGACGATCAAACTTGA
CTATCTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA
TTA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved