snOPY snoRNA Orthological Gene Database
Gallus_gallus
28S rRNA
AADN02004144, DQ018757
1938
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ttggtggtagtagcaactattcaaacgagagctttgaaggccgaagtggagcagggttcc
atgtgaacagcagttgaacatgggtcagtcggtcctaagcgataggcgagcgccgttccg
aagggacgggcgatggcctccgttgccctcagccgatcgaaagggagtcgggttcagatc
cccgaatccggagcggcggagacgggcgccgcgaggcgcccagtgcggtaacgcaagcga
tcccggagaagccggcgggagccccggggagagttctcttttctttgtgaagggccgggc
gccctggaacgggttcgccccgagagaggggcccgcgccttggaaagcgtcgcggttccg
gcggcgtccggtgagctctcgctggcccgtgaaaatccgggggagagggtgtaaatctcg
cgccgggccgtacccatatccgcagcaggtctccaaggtgaacagcctctggcatgttgg
accaatgtaggtaagggaagtcggcaagccggatccgtaacttcgggataaggattggct
ctaagggctgggtcggtcgggctggggcgcgaagcggggctgggcgcgcgccgcggctgg
acgaggcgccgcccgcccccgccccccctttccccgctcccgctcgccggggcgccgggg
gggggggtcagcgggcggcgcggcggcggcgactctggacgcgcgccgggcccttcccgt
ggatcgccccagctgcggcgggcgccgctcgcccccctccttgcccctccgcccccccgc
tcccggcgcccctcccgtcggccgtcgtcccggccgccccccgtcccgagcgccctcccc
gcgagggcgcgaggggcggcggcggcggccgcgggcgcggcggcggcgggggggggcccg
ccggcggcgccgggcggggcggtcccgggcggggggggtctccgggccggcgccccgcct
cggccggcgcctagcagccggcttagaactggtgcggaccaggggaatccgactgtttaa
ttaaaacaaagcatcgcgaaggcccgcggcgggtgttgacgcgatgtgatttctgcccag
tgctctgaatgtcaaagtgaagaaattcaatgaagcgcgggtaaacggcgggagtaacta
tgactctcttaaggtagccaaatgcctcgtcatctaattagtgacgcgcatgaatggatg
aacgagattcccactgtccctacctactctccagcgaaaccacagccaagggaacgggct
tggcggaatcagcggggaaagaagaccctgttgagcttgactctagtctggcgctgtgaa
gagacatgagaggtgtagaataagtgggaggccccgcggtcgcgcgacccgcgccgcggc
ccggccgccggtgaaataccactactctgatcgttttttcacttacccggtgaggcgggg
gggcgagccccgaggggctctcgcttctggcgccaagcgcccggcgcgcgccgggcgcga
cccgctccggggacagcgtcaggtggggagtttgactggggcggtacacctgtcaaagcg
taacgcaggtgtcctaaggcgagctcagggaggccagaaacctcccgtggagcagaaggg
caaaagctcgcttgatcttgattttcagtacgaatacagaccgtgaaagcggggcctcac
gatccttctgactttttgggttttaagcaggaggtgtcagaaaagttaccacagggataa
ctggcttgtggcggccaagcgttcatagcgacgtcgctttttgatccttcgatgtcggct
ctccatcatggagagatcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnn
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved