snOPY snoRNA Orthological Gene Database
Felis_catus
28S rRNA
AF353617
4531
cgcgacctcagatcagacgtggcgacccgctgaatttaagcatattagtcagcggaggaa
aagaaactaacgaggattccctcagtaacggcgagtgaacagggaagagcccagcgccga
atccccgccccgcggtggggcgcgggaaatgtggcgtacggaagacccactccccggcgc
cgctcgtggggggcccaagtccttctgatcgaggcccagcccgtggacggtgtgaggccg
gtagcggcccccggcgcgccgggcccgggtcttcccggagtcgggttgcttgggaatgca
gcccaaagcgggtggtaaactccatctaaggctaaataccggcacgagaccgatagtcaa
caagtaccgtaagggaaagttgaaaagaactttgaagagagagttcaagagggcgtgaaa
ccgttaagaggtaaacgggtggggtccgcgcagtccgcccggaggattcaacccggcggc
gggtccggccgtgccggcggtccggcggatctttcccgccccccgttcctcccgacccct
ccacccgccctccctcccccgccgtccctcctctccggaggggggctccggcgggtgcgt
gggggggcgggcggggccgggggtggggccggcgggggaccgccccccggccggcgaccg
gccgccgccgggcgcatttccaccgcggcggtgcgccgcgaccggctccgggacggctgg
gaaggccggcggggaaggtggctcggggggccccgctctctcccgagggcgggcccaccc
cccgagtgttacagccccccggcagcagcgctcgccgaatcccggggccgagggagcaga
ccgtcgccgcgctctcccccctcccggcgcccacccccgcgggggctcccccgcgagggg
gtcccccccgcgggggcgcgccggtgtcgggggggccgggccgcccctcccacggcgcga
ccgctcccccaccccccccgcccccggcgacggggcgcgcgggggggcggggcggactgt
ccccagtgcgccccgggcgggtcgcgccgtcgggcccggggggtttccaggcgccacgcc
gtgaccaaagcacagcgaagcgagcgcacggggtcagcggcgatgtcggccacccacccg
acccgtcttgaaacacggaccaaggagtctaacacgtgcgcgagtcaggggctcgcacga
aaagccgccgtggcgcaatgaaggtgaaggccggcgctgctcgccggccgaggtgggatc
ccgaggcctctccagtccgccgagggcgcaccaccggcccgtctcgcccgccgcgccggg
gaggtggagcatgagcgcacgtgttaggacccgaaagatggtgaactatgcctgggcagg
gcgaagccagaggaaactctggtggaggtccgtagcggtcctgacgtgcaaatcggtcgt
ccgacctgggtataggggcgaaagactaatcgaaccatctagtagctggttccctccgaa
gtttccctcaggatagctggcgctctcgcacgcgaacccacgcagttttatccggtaaag
cgaatgattagaggtcttggggccgaaacgatctcaacctattctcaaactttaaatggg
taagaagcccggctcgctggcgtggagccgggcgtggaatgcgagtgcctagtgggccac
ttttggtaagcagaactggcgctgcgggatgaaccgaacgccgggttaaggcgcccgatg
ccgacgctcatcagaccccagaaaaggtgttggttgatatagacagcaggacggtggcca
tggaagtcggaatccgctaaggagtgtgtaacaactcacctgccgaatcaactagccctg
aaaatggatggcgctggagcgtcgggcccatacccggccgtcgctggcagtcggtgacgc
gcgcgagagggacgggagcgggcggggggggcgcggtggtttcccttcccgggggggccg
ccgcctccccccaacccccaccccgcggacgctacgccgcgacgagtaggagggccgctg
cggtgagccttgaagcctagggcgcgggcccgggtggagccgccgcaggtgcagatcttg
gtggtagtagcaaatattcaaacgagaactttgaaggccgaagtggagaagggttccatg
tgaacagcagttgaacatgggtcagtcggtcctgagagatgggcgagcgccgttccgaag
ggacgggcgatggcctccgttgccctcagccgatcgaaagggagtcgggttcagatcccc
gaatccggagtggcggagatgggcgccgcgaggcgtccagtgcggtaacgcaaccgatcc
cggagaagccggcgggagccccggggagagttctcttttctttgtgaagggcagggcgcc
ctggaatgggttcgccccgagagaggggcccgtgccttggaaagcgtcgcggttccggcg
gcgtccggtgagctctcgctggcccttgaaaatccgggggagagggtgtaaatctcgcgc
cgggccgtacccatatccgcagcaggtctccaaggtgaacagcctctggcatgttggaac
aatgtaggtaagggaagtcggcaagccggatccgtaacttcgggataaggattggctcta
agggctgggtcggtcgggctggggcgcgaagcggggctgggtgcgcgccgcggctggacg
aggcgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnntcattcctccaccgaagatgggcagggttta
tcagatgcgcaggttttcacagatttcaagtcatactaaagaagcatgagctttattata
ggcggggaggggggtggtgtgaaatacaggaacagatgcaaaaaaaggtttgttggagga
aaattcacatggaaacataaagtggttgggacttggaggccacgcggagcgtagcatcat
tcaatatatactgtccccccctccgggtccgcccccgggccgcggttccgcgcggcgcct
cgcctcggccggcgcctagcagccgacttagaactggtgcggaccaggggaatccgactg
tttaattaaaacaaagcatcgcgaaggcccgcggcgggtgttgacgcgatgtgatttctg
cccagtgctctgaatgtcaaagtgaagaaattcaatgaagcgcgggtaaacggcgggagt
aactatgactctcttaaggtagccaaatgcctcgtcatctaattagtgacgcgcatgaat
ggatgaacgagattcccactgtccctacctactatccagcgaaaccacagccaagggaac
gggcttggcggaatcagcggggaaagaagaccctgttgagcttgactctagtctggcacg
gtgaagagacatgagaggtgtagaataagtgggaggcccccggcgcccccccgtccccgc
gagggggcggggcggggtccgccggccttgcgggccgccggtgaaataccactactctta
tcgttttttcactgacccggtgaggcgggggggcgagccccgaggggctctcgcttctgg
cgccaagcgcccggccgcgccggccgggcgcgacccgctccggggacagtgccaggtggg
gagtttgactggggcggtacacctgtcaaacggtaacgcaggtgtcctaaggcgagctca
gggaggacagaaacctcccgtggagcagaagggcaaaagctcgcttgatcttgattttca
gtacgaatacagaccgtgaaagcggggcctcacgatccttctgaccttttgggttttaag
caggaggtgtcagaaaagttaccacagggataactggcttgtggcggccaagcgttcata
gcgacgtcgctttttgatccttcgatgtcggctcttcctatcattgtgaagcagaattca
ccaagcgttggattgttcacccattaatagggaacgtgagctgggtttagaccgtcgtga
gacaggttagttttaccctactgatgatgtgttgttgccatggtaatcctgctcagtacg
agaggaaccgcaggttcagacatttggtgtatgtgcttggctgaggagccaatggggcga
agctaccatctgtgggattatgactgaacgcctctaagtcagaatcccgcccaggcggaa
cgatacggcagcgccgcggagcctcggttggcctcggatagccggtcccccgccgtcccc
gccggcgggccgccgcgcgcgccccgcgtggcgtggcgtgccccgccgcgcgtcgggacc
ggggtccggtgcggagagcccctcgtcccgggaatcggggcgcggccggaaagggggccg
ccccctcgcccgtcacgcaacgcacgttcgtggggaacctggtgctaaaccattcgtaga
cgacctgcttctgggtcggggtttcgtacgtagcagagcagctccctcgctgcgatctat
tgaaagtcagccctcgacacaagggtttgtc
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved