snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus
28S rRNA
AANN01759471
2803
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGAGCCGCCGCAGGTGCCAGATCTTGGTGGTAGTAGCAAATATTCCAATAGAGAACTTTG
AAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCT
GAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCGGCCGA
TCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGACGGGCGCCGCGAGG
CGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTC
TCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGT
GCCTTGGAAAGCGTCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAAT
CCGGGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAA
GGTGAACAGCCTCTGGCATGTTGGAACAATGTAGGTAAGGGAAGTCGGCAAGCCGGATCC
GTAACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCG
GGGCTGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCCCCCCTCGCCCGCGGCCCGGG
GTCCACCCCCGGTCGCGGCCCGTCCCCCCCCCGCCCCGACCCTCTCCCTTCCCCGTGCGG
TCCCCTCTCTCTCCGCCGCTCCCTCCTCCCCCTTTCTTCCCCGTCCCCCTCCCCCCTCTC
TCCCTCTCTCTCTCTCCGGTCCTCTCCCCTCGCGGGGGGGGGGTGGTGGGGGAAGAGGAG
AAGGGTGGGGTCGGGTGGTGGCGGGGGGAGAAGGGGGCGGGGGCGGCGCGGGAGGGGGCG
GCGGGGGCCGCGGGGGAGAGGGCCCCCGGCGGCGGCGGTGGGGTCCGGGTCCCCCCTCGG
GGGCCCGGGCGTCCCACGGGCGGGGGGCCGGCGGCGGCGGCGACTCTGGACGCGAGCCGG
GCCCTTCCCGTGGATCGCCCCAGCTGCGGCGGGCGTCGCGGCCGCTCCCCGGGGAGGCGG
TCTCCCCCTCCTCCGCCCTCCCTCCGCTCGCGGGCGGGGTGGCGGGCGGGGGTGCGGGCG
GGGCCGCCCTCCCCCCGGGGGCCGCGGTTCCGCGCGGCGCCTCGCCTCGGCCGGCGCCTA
GCAGCCGACTTAGAACTGGTGCGGACCAGGGGAATCCGACTGTTTAATTAAAACAAAGCA
TCGCGAAGGCCCGCGGCGGGTGTTGACGCGATGTGATTTCTGCCCAGTGCTCTGAATGTC
AAAGTGAAGAAATTCAATGAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAG
GTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGAATGGATGAACGAGATTCCCA
CTGTCCCTACCTACTATCCAGCGAAACCACAGCCAAGGGAACGGGCTTGGCGGAATCAGC
GGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCTGGCACGGTGAAGAGACATGAGAGG
TGTAGAATAAGTGGGAGGCCCCCGGCGTCCCCCCGTGACCCCGCGAGGGGCCGGGGCGGG
TCCGCCGGCCTTGCGGGCCGCCGGTGAAATACCACTACTCTGATCGTTTTTTCACTGACC
CGGTGAGGCGGGGGGGCGAGCCCCGAGGGGCTCTCGCTTCTGGCGCCAAGCGCCCGGCCG
GCGTCGGCCGGGCGCGACCCGCTCCGGGGACAGTGCCAGGTGGGGAGTTTGACTGGGGCG
GTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAGGGAGGACAGAAACCT
CCCGTGGAGCAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTCAGTACGAATACAGACCG
TGAAAGCGGGGCCTCACGATCCTTCTGACCTTTGGGGTTTTAAGCAGGAGGTGTCAGAAA
AGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTG
ATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGT
TCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTAC
CCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTT
CAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGG
ATTATGACTGAACGCCTCTAAGTCAGAATCCCGCCCAGGCGGAACGATACGGCAGCGCCG
CGGGAGCCTCGGTTGGTCTCGGATAGCCGGGTCCCCGTTCAGTCCCCGCCGGCCGGCCGG
CCGGTGGGCGCGGCGCGGGCCCGCGCGCTCGCGTCCGCGCCCCGCCGCCGCCGCCGCCGC
GCGTTCGGGACCGGGGCCCGGTGCGGAGAGCCGCTCGTCCTGGGAAGCGGGGCGCGGCCG
GAAAGGCGGCCGCCCCCTCGCCCGTCACGCACCGCACGTTCGTGGGGAACCTGGTGCTAA
ACCATTCGTAGACGACCTGCTTCTGGGTCAGGGTTTCGTACGTAGCAGAGCAGCTCCCTC
GCTGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGTCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved