snOPY snoRNA Orthological Gene Database
Equus_caballus
28S rRNA
EU081775
1505
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ggccgggcgcccagccggccaaccttagaacctggacaagaccagggggaatccgtctgt
ttaatttaaaacaatgcatttgcgaaggccccgcggcgggtgttgaagtgatgtgatttc
tgccccagtgctctgaatgtcaaagtgaagaaagtcaatgaagcgcgagtagatggcggg
agtacctatgactctcttaaggtagccaaatgcctcgtcatctaattagtgacgcgcatg
aatggatgaaggagattcccactgtccctaactgttatccagcgaaaccacagccaaggc
aacgggcttggcggaatcagcggggaaagaagaccctgttgagcttgactctagtctggc
atggtgaagagacatgagaggtgtagaacaagtggaaggcccccttgcgggccgccggtg
aaataccactactctgatcgctttttcactgaccgggtgaggtggggggcgagccccaag
gggctctcgcttctggcgccaagcgcccggcccggccgccgggcaagacccgctccgggg
acagtgccagatggggagtttgactggggcggtacacctgtcaaacggtaacgcaggtgt
cctaaggcgagctcagggaggacagaaacctcccgtggagcagaagggcaaaagctcgct
tgatcttgattttcagtacgaatacagacggtgaaagcggggcctcacgatccttctgac
cttaggggttttaagcaggaggtgtcagaaaagttaccacagggataactggcttgtggc
ggccaagcgttcatagcgacgtcgctttttgatccttcgatgtcggctcttcctatcatt
gtgaagcagaattcaccaagcgttggattgttcacccactaatagggaacgtgagctggg
tttagaccatcgtgagacaagttagttttaccctattgatgatgtgttattgccatggta
atcctgctcggtgcgagaggaaccgcaggttcagacatttggtgtatgtgcttggctgag
gagccaatggggcgaagctaccatctgtgggattatgactgaacgcctctaagtcagaat
cctgcccaggtggaacgatatggcagggcctcgggagcctcggttggcctcggatagccg
ggtccccgccgtccccgccggcgggccgccgtgcgcgcagcccctgcatcggcacggcgc
gcccccgccacgcgtggggactggggtccggtgtggagagcccctctcccgggacacaga
gcgcggccggaaaggcggccgcccccttgcctgtcacgcagcacacgttcgtggggaacc
tggcgctaaagcatttgtagacgacctgcttctgggtcagggtttcgaacgtagcagagc
agctcgctcgctgcgatctagttaaagtcagccctcaacacaagcgtttgtctatgggtc
cttcc
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved