snOPY snoRNA Orthological Gene Database
Echinops_telfairi
28S rRNA
2524
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCAGCGGAGGAA
AAGAAACTAACCAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAAGAGCCCAGCGCCGA
ATCCCCGGCCCGCGGTGGGGCGTGGGACATGTGGCGTACGGAAGACCCACTCCCCGGCGT
CGCTCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCAGCCCGTGGACGGTGTGAGGCCG
GTAGCGGCCCCCGGCGCGCCGGGCTCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCA
GCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGCCAA
CAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAA
CCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGC
GGGTCCGGCCGTTGCCGGCGGCCCGGCGGATCTTTCCCGCTCCCCGTTCCTCCCGACCCC
TCCACCCGTCCTCTCTCTCTCTCGGTGCCCGCTCCGGCGGGTGTCGCGGGGGGTGGGGCG
GGCGGGGCCGGGGGTGGGGCCGGCGGGGGACCGCCCCCCGGCCGGCCATCGGCCGCCGCC
GGGCGCATTTCCACCGCGGTGGTGCGCCGCGACCGGCTCCGGGACGGCTGGGAAGGCCGG
TGGGGAAGGTGGCTCGGGGGGGCCCCGGTCTCTCCTCCCTCGCGGGGGGGGGGTCTCCGG
GAACTCTCTCCTCCCCGAGTGTTACAACCCCCCGGCAGCAGCGCTCGCCGAATCCCGGGG
CCGAAGAAGACCGAACGTCGCCGCGCTCTCCCCCCTCCCGGCGCTCACCCTCGCTGAGGC
CCCCTCCGTCCGAGAGAGATCCACCTCCGCGGAGGCGCGCCGGTGCCGAGAGAGCCGAGC
CGCCCCTCCCGCGGCGCGACCGCTCCCCCACCCTCCCCCGCCTCCACGGCGGGATCCAGG
GCGGGGCGGACTGTCCTCAGTGCGCCCCGGGCGTGTCGCGCCGTCGGGCCCCGGGGGCAT
CGGCCACGCCGTGCCAGCCACAGCGAAGCGAGCGCACGGGGTCGGCGGCGATGTCGGCCA
CCCACCCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACACGCGCGCGAGTCAGGGGC
TCGCGCGAAAGCCGCCGTGGCGCAATGAAGGTGAAGGCCGGCCTTCGTCCGCCGGCCGAG
GTGGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTCTCGCCCGCC
GCGTCGGGGAGGTGGAGCACGAGCGCGCGTGTTAGGACCCGAAAGATGGTGAACTATGCC
TGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGACGTGCAAA
TCGGTCGTCCGACCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTC
CCTCCGAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCAGGAAAAAAACGGGGCAGTTTTA
TCCGGTTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACCGATCTCAACCTATTCTCAA
ACTTTAAATGGGTCAGAAGCCCGGCTCGCTGGCTTGGAGCCGGGGCGTGGAATGCGAGTG
CCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTT
AAGGCGCCCGATGCCGACGCTCATCAGACCCCAGAAAAGGTGTTGGTTGATATAGACAGC
AGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAA
TCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGG
CAGTCGGGACGCGCGCGCGAGAGGGACGGGAGCGACCCCGACCTCGATCCGCCGGACGCT
ACGCCGCGACGAGTAGGAGGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGCGGGCCCGG
GTGGAGCCGCCGCAGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTG
AAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCT
GAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTCGCCCTCGGCCGA
TCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGACGGGCGCCGCGAGG
CGTCCAGTGCGGTAACGCAACCGATCCCGGAGAAGCCGATGGGAGCCCCGGGGAGAGTTC
TCTTTTCTTTGACTAGGGCAGGGCGCCCTGGAATGGTGTCTCACTCGCTCCCAGGGGGCC
GCGCCTTGGAAAGCGGCGCAACTTCAGCGGCGCTCGGTGAGTTCTCATACGGCCCTTGAA
GGAGTCGAGGAGAGAACTTAACTTCTCTTACTCTGGCCGCATCGATATTCGAAATGAGTC
TNNN
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved