snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster
U4 snRNA
FBgn0003931
142
ATCTTTGCGCAGAGGCGATATCGTAACCAATGAAGTTCTACTGAGGTGCGATTATTGCTA
GTTGAAAACTTTAACCAATACCCCGCCATGGGGACGTGAAATACCGTCCACTACGGCAAT
TTTTGGAAGCCCGAGAGGGCCA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved