snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster
5.8S rRNA
M21017
123
AACTCTAAGCGGTGGATCACTCGGCTCATGGGTCGATGAAGAACGCAGCAAACTGTGCGT
CATCGTGTGAACTGCAGGACACATGAACATCGACATTTTGAACGCATATCGCAGTCCATG
CTG
snoRNA:Me5.8S-G74 5.8S:G74 C/D
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved