snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus
28S rRNA
AAGV020681670,AAGV020991924, AAGV021008902
1641
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
cccccccgccgggtccgcccccgggccgcggttccgcgcggcgcctcgcctcggccggcg
cctagcagccgacttagaactggtgcggaccaggggaatccgactgtttaattaaacaca
aagcatcgcgaaaggcccgcggcgggtgttgacgcgatgtgatttctgccccagtgctct
gaatgtcaaagtgaagaaatccaatgaagcgcgggtaaacgggcgagagtaactatgact
ctcttaaggtagccaaatgcctcgtcatgtaattagtgacgcgcatgaatggatgaacga
gattcccactgtccctaccctactatccagcgaaaaccacagccaagggaacggccttgg
cggaatcagcggggaaagaagaccctgttgagctggactctagtctggcacggtgaagag
acatgagaggtgtagaataagtgggaggcccccggcgcccccccgtccccgcgagggggc
ggggcggggtccgccggccttgcgggccgccggtgaaataccactactcttatcgttttt
tcactgacccggtgaggcgggggggcgagccccgaggggctctcgcttctggcgccaagc
gcccggccggcgaggccgggcgcgacccgctccggggacagtgccaggtggggagtttga
ctggggcggtacacctgtcaaacggtaacgcaggtgtcctaaggcgagctcagggaggac
agaaacctcccgtggagcagaagggcaaaagctcgcttgatcttgattttcagtacgaat
acagaccgtgaaagcggggcctcacgatccttctgaccttttgggttttaagcaggaggt
gtcagaaaagttaccacagggataactggcttgtggcggccaagcgttcatagcgacgtc
gctttttgatccttcgatgtcggctcttcctatcattgtgaagcagaattcaccaagcgt
tggattgttcacccactaatagggaacgtgagctgggtttagaccgtcgtgagacaggtt
agttttaccctactgatgatgtgttgttgccatggtaatcctgctcagtacgagaggaac
cgcaggttcagacatttggtgtatgtgcttggctgaggagccaatggggcgaagctacca
tctgtgggattatgactgaacgcctctaagtcagaatcccgcccaggcggaacgatacgg
cagcgccgcggagcctcggttggcctcggatagccggtcccccgccgtccccgccggcgg
gccgtcgcgcgcgcccgcgcgcgtggcgccccccgccgcgcgtcgggaccggggtccggt
gcggagtgcccctcgtcccgggaaacggggcgcggccggaaagggggccgccccctcgcc
cgtcacgcaccgcacgttcgtggggaacctggtgctaaaccactcgtagacgacctgctt
ctgggtcggggtttcgtacgtagcagagcagctccctcgctgcgatctattgaaagtcag
ccctcgacacaagggtttgtcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnn
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved