snOPY snoRNA Orthological Gene Database
Danio_rerio
U6 snRNA
107
GTGCTCACTACGGTGGCACATATACTAAAATTGGATTGATACAGAGAAGATTAGCATGGT
CCCTGCGAAAGGATGACACGCAAATCCGTTAAGCGATCCATATTGCT
snoZ30 C/D
SNORD94 C/D
snoU6-53 C/D
snoU6-53 C/D
snoU6-53 C/D
SNORD10 C/D
SNORA79 H/ACA
SNORD94 C/D
SNORD94 C/D
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved