snOPY snoRNA Orthological Gene Database
Danio_rerio
U2 snRNA
191
ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATAT
CTGATACGTGCCCTACCCGGGCACCATATATTAAATTGATTTTTGGAATAGGGAGATGGA
ATAGGGGCTTGCTCCGTCCACTCCACGCATCGACCCGGTATTGCAGTACTTCCGGGAACG
GTGCACCCCCT
snoU2_19 C/D
snoU2_19 C/D
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved