snOPY snoRNA Orthological Gene Database
Danio_rerio
5.8S rRNA
154
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCTAGCTGCGAGA
ACTAATGTGAATTGCAGGACACATCGATCATCGACACTTCGAACGCACTTTGCGGCCCCG
GGTTCCTCCCGGGGCCACGCCTGTCTGAGCGTCG
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved