snOPY snoRNA Orthological Gene Database
Cavia_porcellus
28S rRNA
NT_175492
5062
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCAGCGGAGGAA
AAGAAACTAACAAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAAGAGCCCAGCGCCGA
ATCCCCGCCCCGCGGTGGGGCGCGGGAAATGTGGCGTACGGAAGACCCACTCCCCGGCGC
CGCTCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCAGCCCGTGGACGGTGTGAGGCCG
GTAGCGGCCCCCGGCGCGCCGGGTCCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCA
GCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCAA
CAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAA
CCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGC
GTCGTCCGGCCGTGCCGGTGGTCTCCCGGCGGATCTTTCCCGCCCCCCGTTCCTCCCGAC
CCCTTCACCCGTCCGCCCTCCCGCTCGCCGCCGCTCCTCCTCCCTTCCCGGGAGGGGGGT
GCGCTCCGGCGGGTGCGGGGGACGGGCGGGCGGGGCCGGGGGTGGGGTCGGCGGGGGACC
GCCCCCCGGCCGGCGACCGGCCGTCGCCGGGCGCATTTCCACCGAGGCGGTGCGCCGCGA
CCGGCTCTGGGACGGCTGGGAAGGCCCGGCGGGGAAGGTGGCTCGGGGGGTCCCCCCGCC
CGCGTCGTTCGCGCGGCGCGGGGCCCGGGGGTCCTTCCCCCCCCGAGTGTTACAGCCCCC
CGGCAGCAGCGGCTCGCCGAATCCCGGGGCCGAGGGAGCCAGACCCGTCGCCGCGCTCTC
CCCCCTCCCGGCGCCCACCCGCCGCGGGGGTCTCTCCCGCGAGGGGGAGCCCGCCTCCGC
GACGGGCGCGCCGGCGTTCCCGGGGGGGCCGGGCCGCCCCTCCCACGGCGCGACCGCTCT
CCCACTCCCGCCTCTCCTCCCCCGCGGGGAGGGACGGGGGCGGGGCGGACTGTCCCCAGT
GCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGGGTTCGTGGGCCACGCCCGGGCCAAA
AAAAAAAAAAACCGGGAAGCGAGCGCACGGGGTCGGCGGCGATGTCGGCTACCCACCCGA
CCCGTCTTGAAACACGGACCAAGGAGTCTAACACGTGCGCGAGTCGGGGGCTCGCTCGAA
AGCCGCCGTGGCGCAATGAAGGTGAAGGCCGGCGGTGGCGGCGGCGCGCCGCGGGTGGGG
GGGGTGCGTGGGGTGGGTCCGGGGCGGGGTCGGCGGTGGCGCGCCCGCGCGTCCTCCCGC
CGTTCCCTCGTCCCGTCCCCTCTCCCTCCCCCCTCCGTTTGCCCGCCGCGCCCCGCCTCG
CCGGCCCGAGGTGGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGT
CTCGCCCGCCGCGCCGGGGAGGTGGAGCAGGAGCGCACGTGTTAGGACCCGAAAGATGGT
GAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCT
GACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAG
TAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCAGAAAACCCACGC
AGTTTTATCCGGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATT
CTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCG
AGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCG
GGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAGAAAAGGTGTTGGTTGATATAGA
CAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGC
CGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCG
CCGGCAGTCGGATCTGGACGGGAGCGGGAAGGGGTTCGGAGTCGGTGGTTGGGGGGGGGG
TCCTCCCCCCCCCCCTCCCCGGGGCCGGCCCCGGACGCGTGTCGCCCCGCGGACGCTACG
CCGCGACGAGTAGGAGGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGCGGGCCCGGGTG
GAGCCGCCGCAGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAG
GCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAG
AGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCAGCCGATCG
AAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGTCGCCGCGAGGCGT
CCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCT
TTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGTGCC
TTGGAAAGCGTCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAATCCG
GGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGT
GAACAGCCTCTGGCATGTTGGAACAATGTAGGTAAGGGAAGTCGGCAAGCCGGATCCGTA
ACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCGGGG
CTGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCCCCCCCCACGCCCGGGGTTCCCCC
CTCGCCCGGGCCCGCCCCCGCGGCTCGTTTTCTGTCCCGGGATCTGATTCTGGGACGGGG
CTAGCTATTAGGCTGTATAGTACCCCGGGTATTTTTTTTGGCAAGTGAGTGTTGTAAGGG
TGGGGGGAATTTTAATATCTCCCCACTCCTTACCTCATTCAGACGTTTCCTTATGTTTTT
TCAAAGCCACGACTTAGTAGAACAAAATGCCCAACCCCAACCATCAAGACCTCACTCAAG
CTAAAAAAAGAGAAAATAACAAAACGCCCCTCTACGCGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTCTCCGCGCGGCCCCCCTCCCCTCCTCCCGCCCGAACCCCCTCGGCGTCCCGTCCCGGC
GCGGCGCGCGTCGCCGGCGGGTCCGTTCCCGCCGCGCGCGCGCGCTCCCGGCGGCGTCGG
CGGGGGGGGAGCCGGGCGTCGCGGGGTGGGGTGGGGCGGTCGTCGGTCCCGGGGGGAGCG
GCGAGGCCGGTCCCGCGCCGGTCTCCCCCGCCGGGTGAGCCCCCGGGCCGCGGTTCCGCG
CGGCGCTCCGCCTCGGCCGGCGCCTAGCAGCCGACTTAGAACTGGTGCGGACCAGGGGAA
TCCGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGACGCGATGT
GATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAACG
GCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGC
GCATGAATGGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCC
AAGGGAACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGT
CTGGCACGGTGAAGAGACATGAGAGGTGTAGAATAAGTGGGAGGCCCCCGGCGTCCCCCC
CGTTTCCCGCGAGGGGGCGGGGCGGGGTCCGCCGGCCTCGCGGGCCGCCGGTGAAATACC
ACTACTCTGATCGTTTTTCACTGACCCGGTGAGGCGGGGGGGCGAGCCCGAGGGGCTCTC
GCTTCTGGCGCCAAGCGCCCGGCCCTCCGCGCCGCGTCGCCGCGCGCGCGCGGTCGTCCC
GCCGGGCGCGACCCGCTCCGGGGACAGTGCCAGGTGGGGAGTTTGACTGGGGCGGTACAC
CTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTG
GAGCAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAG
CGGGGCCTCACGATCCTTCTGACCTTTTGGGTTTTAAGCAGGAGGTGTCAGAAAAGTTAC
CACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTT
CGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTTCACCC
ACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACT
GATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACA
TTTGGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGGATTATG
ACTGAACGCCTCTAAGTCAGAATCCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAG
CCTCGGTTGGCCTCGGATAGCCGGTCCCCCGCTCGTCCCCGCCGGCGCGGGGCCGTCGCT
CCCCCGCGCCCCCCGCGCGGGGTCGGCGCGTCCCCGCCGCGCGTCGGGACCGGGGTCCGG
TGCGGAGAGCCCCTCGTCCCGGGAAACGGGGCGCGGCCGGAAAGGAGGCCGCCCTCTCGC
CCGTCACGGAACGCACGTTCGTGGGGAACCTGGCGCTAAACCATTCGTAGACGACCTGCT
TCTGGGTCGGGGTTTCGTACGTAGCAGAGCAGCTCCCTCGCTGCGATCTATTGAAAGTCA
GCCCTCGACACAAGGGTTTGTC
SNORD31 C/D
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved