snOPY snoRNA Orthological Gene Database
Canis_familiaris
28S rRNA
4365
NNNNNNNNNNNNNNNNNNNNNNNNAGACAGTGCAGTGGGCCTCTCTCCCAGAGGACCCGT
TTCGTCTGCCCCACATCCATCAAGTCTACTGATCATAGAGTGTTTCAAAACATCAGCTTC
GGGATCCCTGGGTGGCAACGGTTTGGCGCCTGCCTTCGGCCCAGGGTGTGATCCTGGGGT
CGCGAGATGGAGTCCTGCGTCAGGCTCCTTGCAGGGAGCCTGCTTCTCCCTCTGCCTCTC
TCTCTGTGTCTCTCATGAATAAATAGACTCTTAAAAAAACCAAAAACCAAAAACCAAAAA
ACATCTGCTTTAGTTGTGGTGGAAATAGGACCAGGCTATTCTTTCTTTATATTCTTTCTT
TCTAACTCTGGAAACACTTGAAAAAAATATATATGATCTATTTTGGCTTCTCACCTTTTC
TCTCTTTAATGAATTGATTACTTAACTACTTTTTAACGATTTTATTTATTTCTTCTTAGA
CATGCAAAGCGAGAGAGAGAGAGAGGCAGAGACACATGCACAGGGGAGAAGCAGGCTCCA
TGCATGGAGCCCACTGTGGGACTCGATCCCAGGACTCCAGGATCACCCCCTCTGCCCCTG
GCGGCGGGCCACGCGGGGGGGCCGGGGCGGACTGTCCCCAGTGCGCCCCGGGCGGGTCGC
GCCGTCGGGCCCGGGGGGTCTCCAGGCGCCACGCCGTGACCAAAGCACAGCGAAGCGAGC
GCACGGGGTCAGCGGCGATGTCGGCCACCCACCCGACCCGTCTTGAAACACGGACCAAGG
AGTCTAACACGTGCGCGAGTCAGGGGCTCGCACGAAAGCCGCCGTGGCGCAATGAAGGTG
AAGGCCGGCGGGCGCGCGCGCGCGCCGCTCGCCGGCCGAGGTGGGATCCCGAGGCCTCTC
CAGTCCGCCGAGGGCGCACCACCGGCCCGTCTCGCCCGCCGCGCCGGGGAGGTGGAGCAT
GAGCGCACGTGTTAGGACCCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAG
GAAACTCTGGTGGAGGTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTA
TAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGG
ATAGCTGGCGCTCTCGCACGCGAACCCACGCAGTTTTATCCGGTAAAGCGAATGATTAGA
GGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGG
CTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCA
GAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATC
AGACCCCAGAAAAGGTGTGGGTTGATATAGACAGCAGGACGGTGGCCATGGAAGTCGGAA
TCCGCTAAGGAGTGTGAAACAACTCACCTGCGGAATCAACTAGCCCTGAAAATGGATGGC
GCTGGAGCGTCGGGCCCATACCCGGCCGTCGCTGGCAGTCGGTGACGCGCGCGAGAGGGA
CGGGAGCGGGCGGGGGGGGGCCGCGGCGCGCGCGGCGGTCTTCTCCCTCTCCCGGGGGGG
GGCGGCCGCCGCGTCCGTCGCCCTTCTCTTTCCCCCCCCGACCCCCACCCCGCGGACGCT
ACGCCGCGACGAGTAGGAGGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGCGGGCCCGG
GTGGAGCCGCCGCAGGTACAGGATCTTGGTGGTAGTAGCAAATATCAAACGAGAACTGTG
AAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCT
GAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCAGCCGA
TCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGG
CGTCCAGTGCGGTAACGCAACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTC
TCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGT
GCCTTGGAAAGCGTCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAAT
CCGGGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAA
GGTGAACAGCCTCTGGCATGTTGGAACAATGTAGGTAAGGGAAGTCGGCAAGCCGGATCC
GTAACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCG
GGGCTGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCCCCTCCCACGCCCGGGGCACC
CCCGCCCGGGCCCGCCCCCGCGGCCCTCCTCCGCCCCACCCCGCGCGGCTCCCCCCCGCT
CTCCTCTTCTCCCCCTCCCCCCCTTCCCGGGGGGCGGCGGGGGGCGGGGAGGCGGGGCGG
GGGGGTTGCGGCGGGGCCCCGGCGGCGGGGGAGGTCCCCCGCGGGGCCCGCGGGCCCACG
GGGGCCCGGGCACCCGGGGGGCCGGCGGCGGCGGCGACTCTGGACGCGAGCCGGGCCCTT
CCCGTGGATCGCCCCAGCTGCGGCGGGCGTCGCGGCCGCACCCGGGGAGCCCGGCGGGCG
CCGGCGCGCCCCACCGCGCGCGCGCGCGTGCGCGGCACCGGGTGCCGGGCGGCGGCGGGC
GGCGGCGGGGGTCCCGTCCCCCGTCGCTCCGCTCCGCCGCCCCCGCCCCGCGCCGCCGCC
GCCGCCCGCGGCGGTCGGCGCGCCGGTCCCCCCCGCCGGGTCCGCCCCCGGGCCGCGGTT
CCGCGCGGCGCCTCGCCTCGGCCGGCGCCTAGCAGCCGACTTAGAACTGGTGCGGACCAG
GGGAATCCGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGACGC
GATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGT
AAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGT
GACGCGCATGAATGGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCA
CAGCCAAGGGAACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACT
CTAGTCTGGCACGGTGAAGAGACATGAGAGGTGTAGAATAAGTGGGAGGCCCCCGGCGCC
CCTCCGTCCCCGCGAGGGGGCGGGGCGGGGTCCGCCGGCCTTGCGGGCCGCCGGTGAAAT
ACCACTACTCTTATCGTTTTTTCACTGACCCGGTGAGGCGGGGGGGCGAGCCCCGAGGGG
CTCTCGCTTCTGGCGCCAAGCGCCCGGCCGCGCCGGCCGGGCGCGACCCGCTCCGGGGAC
AGTGCCAGGTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCC
TAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAAAAGCTCGCTTG
ATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCACGATCCTTCTGACCT
TTTGGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGG
CCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGT
GAAGCAGAATTCACCAAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTT
TAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAAT
CCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAGGA
GCCAATGGGGCGAAGCTACCATCTGTGGGATTATGACTGAACGCCTCTAAGTCAGAATCC
CGCCCAGGCGGAACGATACGGCAGCGCCGCGGAGCCTCGGTTGGCCTCGGATAGCCGGTC
CCCCGCCGTCCCCGCCGGCGGGCCGCCGCGCGCGCCCCGCGTGGCGCGGCGTGCCCCGCC
GCGCGTCGGGACCGGGGTCCGGTGCGGAGAGCCCCTCGTCCCGGGAAACGGGGCGCGGCC
GGAAAGGGGGCCGCCCCCTCGCCCGTCACGCAACGCACGTTCGTGGGGAACCTGGTGCTA
AACCATTCGTAGACGACCTGCTTCTGGGTCGGGGTTTCGTACGTAGCAGAGCAGCTCCCT
CGCTGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGTCC
SNORA1 H/ACA
snoR38 C/D
snoR38 C/D
SNORA19 H/ACA
SNORA16 H/ACA
SNORA17 H/ACA
SNORA1 H/ACA
SNORA1 H/ACA
SNORA1 H/ACA
SNORA2 H/ACA
SNORA1 H/ACA
SNORA2 H/ACA
SNORA1 H/ACA
SNORA16 H/ACA
SNORA17 H/ACA
SNORA21 H/ACA
SNORA19 H/ACA
snoMBII-202 C/D
SNORA19 H/ACA
SNORA2 H/ACA
SNORD51 C/D
SNORA2 H/ACA
SNORA2 H/ACA
SNORA21 H/ACA
SNORA1 H/ACA
SNORD32 18S:G1328,28S:A983 C/D
SNORD30 28S:3140 C/D
SNORD31 28S:505 C/D
SNORD38 28S:A1320 C/D
SNORD38 28S:A1320 C/D
SNORD24 28S:A1777 C/D
SNORD34 28S:A2249 C/D
SNORD37 28S:A3033 C/D
SNORD46 28S:A3075 C/D
SNORD15 28S:A3100 C/D
SNORD15 28S:A3100 C/D
SNORD29 28S:A396 C/D
SNORD29 28S:A396 C/D
SNORD18 28S:A707 C/D
SNORD18 28S:A770 C/D
SNORD18 28S:A770 C/D
SNORD18 28S:A770 C/D
SNORD48 28S:C1705 C/D
SNORD55 28S:C2217 C/D
SNORD47 28S:C3202 C/D
SNORD47 28S:C3202 C/D
SNORD50 28S:C3274 C/D
SNORD49 28S:C3765 C/D
SNORD35 28S:C3845 C/D
SNORD35 28S:C551 C/D
SNORD50 28S:G2289 C/D
SNORD53 28S:G3174 C/D
SNORD12 28S:G3214 C/D
SNORD12 28S:G3214 C/D
SNORD111 28S:G3259 C/D
SNORD102 28S:G3353 C/D
SNORD58 28S:G3537 C/D
SNORD58 28S:G3537 C/D
SNORD41 28S:G3614 C/D
SNORD26 28S:G495 C/D
SNORD21 28S:G760 C/D
SNORD52 28S:U3240 C/D
SNORD52 28S:U3240 C/D
SNORD35 28S:U3848 C/D
SNORD17 29S:U3133 C/D
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved