snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans
U4 snRNA
NR_000584.1
144
AGCTTTGCGCTGGGGCGATAACGTGACCAATGAGGCTTTGCCGAGGTGCGTTTATTGCTG
GTTGAAAACTTTTCCCAATTGCCCGCGATGTCCCCTGAAACATGGGTGGCATACGCAATT
TTTGAACGCCTCCAGGAGGCAGAA
JC8.15 U4:U62 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved