snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans
U5 snRNA
X51385
122
AACTCTGGTTCCTCTGCATTTAACCGTGAAAATCTTTCGCCTTTTACTAAAGATTTCCGT
GCAAAGGAGCATTTACTGAGTATTACATACAATTTTTGGAGACTCCTTGAGAAAGCGGGT
CA
K12D12.8 C/D
C50C3.13 U2:U16,U5:U36 H/ACA
K12D12.7 U5:U45 H/ACA
B0393.10 U5:U48 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved