snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans
U6 snRNA
NR_002641
102
GTTCTTCCGAGAACATATACTAAAATTGGAACAATACAGAGAAGATTAGCATGGCCCCTG
CGCAAGGATGACACGCAAATTCGTGAAGCGTTCCAAATTTTT
W05B2.9 U6:A48 C/D
Y116A8C.50 U6:C55 C/D
F22D6.16 U6:U26 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved