snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans
U2 snRNA
NR_000142
187
ATCGCTTCTTCGGCTTATTAGCTAAGATCAAAGTGTAGTATCTGTTCTTATCGTATTAAC
CTACGGTATACACTCGAATGAGTGTAATAAAGGTTATATGATTTTTGGAACCTAGGGAAG
ACTCGGGGCTTGCTCCGACTTCCCAAGGGTCGTCCTGGCGTTGCACTGCTGCCGGGCTCG
GCCCAGT
C07H6.10 U2:C42 C/D
D1054.17 U2:G12 C/D
C50C3.13 U2:U16,U5:U36 H/ACA
C50C3.14 U2:U41 H/ACA
Y62F5A.11 U2:U49 C/D
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved