snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans
5.8S rRNA
X03680
153
CTAGCTTCAGCGATGGATCGGTTGCATCGAGTATCGATGAAGAACGCAGCTTGCTGCGTT
ACTTACCACGAATTGCAGACGCTTAGAGTGGTGAAATTTCGAACGCATAGCACCAACTGG
GCCTCCAGTTGGTACGTCTGGTTCAGGGTTGTT
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved