snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans
26S rRNA
X03680
3509
CTCAACCTGAACTCAGTCGTGATTACCCGCTGAACTTAAGCATATCATTTAGCGGAGGAA
AAGAAACTAAAAAGGATTCCCTTAGTAACGGCGAGTGAAACGGGAAGAGCCCAGCGCCGA
ATCGATCAGTCTTTGGCTGCTTCGAAATGTGGCGTATAGGTGTAAGTTTCCAGCAGTGTC
GTATGTCCGAAGTCCTTACGATTGAGGCCATAAACCAGAGAGGGTGCGAGCCCCGTTCTG
GATAGCGGCACTGTTGGTTCGCTTGCTCCTTGGAGTCGGGTTGCTTGAAAGTGCAGCCTA
AAGTGGGTGATAAACTTCATCTAAGGCTAAATATCGACTCGATTGCGATAGCGAACAAGT
ACCGTGAGGGAAAGTTGCAAAGGACTTTGAAGAGAGAGTTCAAGAGAACGTGAAATCGCT
GGAGTGGAACCGGAGACAGTTGATGTTGCTTGGAGACAAGCTTGGTGACTGGTCGCTTAG
TTGTGATCGTTGCCGGGTGTCGTTTCCTATGCTACGCCGACGGCGTTGGCTGCTCGTTCT
AGCCCGACAGTGTTGCCCATCTCGCAAGAGAAGGTGTCTTGCTGGCGGTAGTGGGTTCGT
GGCGGCTAGCGTTTAGTTACGCTAGTGTGTGTGACGTCGGTGTGAAAGTCGACGACGTTT
CCGACCCGTCTTGAAACACGGATTGCGGAGTGCTTGTCTACTGCGAGTCAAAGGGTGTTA
AAACCTTGCGGCGAAATGAAAGTAAAGGTCAGTCTCGAATTGGCCGACGTGGGATCTGTG
TTCTTCGGAGTGCAGCGCACCACGGCCCTGTGCGTGTCACTTGTGACTGTGCAGAGGTTG
AGCAGTTGGCAAACGACCCGAAAGATGGTGAACTATGCCTGAGCAGGATGAAGCCAGAGG
AAACTCTGGTGGAAGTCCGTATCGGTTCTGACGTGCAAATCGATCGATAGACTTGGGTAT
AGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTTCCGAAGTTTCCCTCAGGA
TAGCTGGATCTCAGGCAGTTATATTCGGTAAAGCTAATGATTAGAGGCCTTGGGGACGTA
ATGTCCTCAACCTATTCTCAAACTTTCAATGGATATGAAGTTGCAGTTTCTTTAGTGAAC
TGTCAACGTGAATGCGAGGTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGCTGTGG
GATGAACCAAACGTGGAGTTAAGGTGCCTAACTTCTCGCTCATGAGACCCCATAAAAGGT
GTTGGTTGATATTGACAGCAGGACGGTGGCCATGGAAGTCGGTATCCGCTAAGGAGTGTG
TAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTTAAGCGAGAGACC
TATACTCCGCCGTTGCGACATGTGCGTTGTCTAGCGCCAGGTCGTAACGAGTAGGAAGGT
CGTGGCGGTTGCGTTGAAGGCTATGAGCGTAGGCTCGGCTGGAGCTTCCGTCAGTGCAGA
TCGTAATGGTAGTAGCAAATATTCAAGTTCGATCCTTGAAGACTGAAGTGGAGAAGGGTT
CCACGTGAACAGTAGTTGGATGTGGGTCAGTCGATCCTAAGGTACTGGCGAACGCCTTGT
ATCATCGGTGGCGAAAAGCTTGCTTTTAGTCCCCGCTTGTCGAAAGGGAATAGGGTTAAT
ATTCCCTAACTGAGATGCAAAGATTGTGTTCTTCGGAGCACAAGCGCGGTAACGCATTCG
AACTTGGTTAGTCGCTCAAAGACCGAGCTAGAGTTTTCTTCTCTAGTTAAGGAACGGACT
CCCTGGAATTGGTTCAGCCAGAGATGGGGACGTTGTTTCCGAAAAGCACCGCGGTTTCTG
TGGTGTCTCGTGCTCTTTGAACGGCCCTTAAAACACCAAGGGAGGCTATTAATTTGCACT
CAATCGTACCGATATCCGCATTAGGTCTCCAAGGTGAACAGCCTCTAGTCGATAGAATAA
TGTAGGTAAGGGAAGTCGGCAAACTAGATCCGTAACTTCGGGAAAAGGATTGGCTCCAGT
GGTTGGAACGGTTGGCCAGTTGGTTGATGCTTGTCCGGCGCAGTTCTGTCTGCTTGATAC
TTTCGGGTTGATGGCGGACTAGTGATTGTGCTTGCTTGCGGACGCTTTCTGGTGTGTGCT
TGGACCTCGGTTCTAGTATCCTGATCGCTCATCTAAACAACCGTACTGGAACCGGTACGG
ACTCAGGGAATCCGACTGTCTAATTAAAACAGAGGTGACAGATGGTCCTTGCGGACGTTG
ACTGTCACTGATTTCTGCCCAGTGCTCTGAATGTTAAATCGTAGTAATTCGAGTAAGCGC
GGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATTTAAT
TGTTGACGCGCATGAATGGATTAACGAGATTCCTACTGTCCCTAACTACTTTCTAGCGAA
ACCACAGCCAAGGGAACGGGCTTGGCAAAAATAGCGGGGAAAGAAGACCCTGTTGAGCTT
GACTCTAGTTTGACATTGTGAAGAGTCATGAGAGGTGTAGCATAGGTGGGAGTCTTCGGA
CGACAGTGAAATACCACCACTTTCATCGACTCTTTACTTATTCGGTTAAAAGAGAATTGG
CTTCACGGCCTTTTTTCGAAGCATTAAGCGGAGCCATTTTATGGCACCGTGACTCTCCTC
GAAGACAGTGTCAAGCGGGGAGTTTGACTGGGGCGGTACATCTATCAAATCGTAACGTAG
GTGTCCTAAGGCGAGCTCAGAGAGGACGGAAACCTCTCGTAGAGCAAAAGGGCAAAAGCT
TGCTTGATCTTGACTTTCAGTACGAGTACAGACCGCGAAAGCGTGGCCTATCGATCCTTT
TAATCCTGATTGTTTCAGGTAAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTG
TGGCAGCCAAGCGTCCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTAT
CATTGCGAAGCAGAATTCGCCAAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGC
TGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGTTGACTTGTTATTGCGAA
AGTAATCCTGCTTAGTACGAGAGGAACAGCGGGTTCAAACATTTGGTTCATAGACTTGAT
CGACAGATCAATGGTCTGAAGCTACCATTTGAGAGATTATAACTGAACGCCTCTAAGTTA
GAATCTCGCCTTGTCAAGGCGAAAATTTCTTGCTTCCCGGTGTCGGGAGGCATCTCTATC
TCGTGGCAACACGAGAGCTTATGCCCTATGTATGGCCTTGGCGTCGTAGTGAATTCTGCG
ACGCTTGCCAACGCCAGATCACTCTGGTTCAATGTCGGGGCGCTAAATCACTTGCATACG
ACTTGGTCTCTTGGTCAAGGTGTTGTATTCAGTAGAGCAGTCCTTTTATACTGCGATCTG
TTGAGACTATCCTTTGATTGAGTTTTTTG
T10B9.11 C/D
T19B4.8 C/D
F32E10.10 C/D
T27A3.9 C/D
B0041.9 C/D
F01D5.12 C/D
K08E3.11 C/D
K11C4.6 C/D
Y43F8C.22 18S:U1146,26S:U940 H/ACA
B0412.7 18S:U513,26S:U2977 H/ACA
W08G11.6 18S:U513,26S:U2977 H/ACA
CeSSU-970 18S:U970,26S:U2847 H/ACA
B0334.12 26S:A1185 C/D
ZK484.9 26S:A1514 C/D
M106.6 26S:A2317 C/D
Y53F4B.47 26S:A2384 C/D
F56C9.12 26S:A2384 C/D
C16D9.10 26S:A2429 C/D
C07A9.14 26S:A3023 C/D
C55F2.3 26S:A3087 C/D
T06D8.11 26S:A3159 C/D
ZK265.10 26S:A395 C/D
C18A3.12 26S:A678 C/D
ZK994.7 26S:A862 C/D
F30H5.4 26S:C1502 C/D
R12E2.17 26S:C2300 C/D
T03F7.8 26S:C2407 C/D
C46C2.8 26S:C2440 C/D
C53B7.8 26S:C2440 C/D
W04D2.7 26S:C3060 C/D
C51F7.3 26S:C3071 C/D
Y55F3BR.9 26S:G2343 C/D
C27H5.9 26S:G2731 C/D
F55A11.10 26S:G2903 C/D
Y71D11A.7 26S:G668 C/D
T06C12.16 26S:G860 C/D
K07C5.10 26S:U1058 H/ACA
D1046.6 26S:U1176 H/ACA
F38E11.14 26S:U1566 C/D
T24H7.6 26S:U1573,26S:U2040,26S:U2454 H/ACA
T08B2.13 26S:U1996 H/ACA
K11H12.12 26S:U2294,26S:U2417 H/ACA
K11H12.13 26S:U2294,26S:U2417 H/ACA
F17C11.14 26S:U2361 H/ACA
Y74C9A.6 26S:U2417 C/D
F28C6.11 26S:U2483 H/ACA
B0213.18 26S:U2519 H/ACA
R151.11 26S:U2519,26S:U2558 H/ACA
F28D1.13 26S:U2519,26S:U2558 H/ACA
K07C10.2 26S:U2762 C/D
K02C4.8 26S:U2836 H/ACA
H09I01.2 26S:U2841 C/D
F53G12.12 26S:U2966,26S:U3035 H/ACA
C16A3.11 26S:U2966,26S:U3035 H/ACA
C10C6.8 26S:U2992 H/ACA
C14C10.8 26S:U3220,26S:U2828,26S:U1270 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved