snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana
U2 snRNA
AJ505690
195
ATACCTTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATA
TCTGATATGTGGGCCATCGGCCCACACGATATTAACTCTATTTTTTAAGGGAGAAAGCCC
ACTAAGATAGCTTGCTATCTGGGCTTTCACGAGTCGCCCATGCGTTGCACTACTGCACGG
GCCTGGCTCAACCCG
SnoR101 U2:C29,25S:C335 C/D
SnoR104 U2:U42 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved