snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana
U5 snRNA
AJ505694
123
ACGCAGCCATGTGGTGAGCACAAAGCGAACTATTCTTTCGCCTTTTACTAAAGAATACCG
TGTGCTCTCCACGCTAAGTGGCATACGCCTATTTTTGGAGGGTCCTGCTTTCGAGTGGGC
CCA
SnoR102 U5:G41,18S:A760 C/D
SnoR102-2 U5:G41,18S:G1278 C/D
SnoR103 U5:U47,U5:U50 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved