snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD77
sequence
ATACCTATATAACTGCATTGTTCAGCAGATTGAATATACAATGCAGCTATGGCTGTATA
C
  Box motif
  Complementary to target RNA
length 60
organism Xenopus_tropicalis
snoRNA name SNORD77
alias
chromosome ⁄ contig scaffold_4841
locus ⁄ host gene ENSXETG00000023692
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved