snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORA5
sequence
TGCAGCCATGTCAAATTCAGCGTTGCCTTATCCCTGGCAGCTACTGGCCCAAGTGGCTG
CAACAGCAACATGGTAGCTCATGGGCCTCGCTTTCCCTTGTAGCGGAATTCGAGGATAAA
ATTGTGCTACGGACAGAT
  Box motif
  Complementary to target RNA
length 137
organism Xenopus_tropicalis
snoRNA name SNORA5
alias
chromosome ⁄ contig scaffold_757
locus ⁄ host gene BC075328.1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved