snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORA19
sequence
CTGCACATTTCATTGACACACTCCTAGAATTGTGATGAGCCGTGTTATTTCTAATGTGC
TAAATCAATAGGAGGCTAATTAGCAGTGTAACGGAATTGTTACCACTGCCAGTCCCCTTC
TCACAGCC
  Box motif
  Complementary to target RNA
length 127
organism Xenopus_tropicalis
snoRNA name SNORA19
alias
chromosome ⁄ contig scaffold_605
locus ⁄ host gene ENSXETG00000010241
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved