snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORA42
sequence
GCATGGTTATGGATTTATGGTGTGGCCCACACATGGCTACCTCATAGTGTACCCCATGC
TAGATCAAGCTGCTGCTCCGAACCATTGGCAGGTGTATATCTGTGAGCCTGATCCACTGA
AGAGAGCTGTATAGCT
  Box motif
  Complementary to target RNA
length 135
organism Xenopus_tropicalis
snoRNA name SNORA42
alias
chromosome ⁄ contig scaffold_322
locus ⁄ host gene SSR4
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved