snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD14
sequence
TCGCTGTGATGAATTTGATTCCAAAGCCATTCGTAGTTTCCACCAGATGTCGCAAGACT
TATGATGGTTTATTACCTTCCTTGGATGTCTGAGCGA
  Box motif
  Complementary to target RNA
length 96
organism Xenopus_tropicalis
snoRNA name SNORD14
alias
chromosome ⁄ contig scaffold_298
locus ⁄ host gene ENSXETG00000013038
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved