snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD20
sequence
TGGAAGTGATGAGCTGTTATCTGAGAATTTTGTGATGAAAATTAACAATTTCTCTAGAT
AGTCAAGTACTGATCCAG
  Box motif
  Complementary to target RNA
length 77
organism Xenopus_tropicalis
snoRNA name SNORD20
alias
chromosome ⁄ contig scaffold_285
locus ⁄ host gene TGas012o17.1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved