snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD94
sequence
ACGACTGTGATGATTGGCACAGGGGTACGGACCTCAGCTGGATCATGGGAGCTGAATGT
GAACTTCCCCCTGAGGTTCCTGCATGTGGTGGGATACCCGGGGGGGCGTTCATATGAGAA
CAGAGCCTTAATCTGAGCCGC
  Box motif
  Complementary to target RNA
length 140
organism Xenopus_tropicalis
snoRNA name SNORD94
alias
chromosome ⁄ contig scaffold_280
locus ⁄ host gene BC090356.1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved