snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORA2
sequence
ATGGCCCTGAATCAAGGCTGGCTGCTTGTTGTAGCTGTGAGTTTCAAACAGGAGCCTAA
ATCAAATTCTTCTTGTGGTCTGTTGGCTGTGCCATTGCAATAGGGCCCATCCTATTCAGT
TGGAAGAAACAAGC
  Box motif
  Complementary to target RNA
length 133
organism Xenopus_tropicalis
snoRNA name SNORA2
alias
chromosome ⁄ contig scaffold_130
locus ⁄ host gene C12orf41
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved