snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD59
sequence
CCTTCTATGATGATTTTTTCATTTGACTTTCGTTCTTCTGAGTTATTCTGAAGCGATTT
TATATAGTCTGAAAAGG
  Box motif
  Complementary to target RNA
length 76
organism Xenopus_tropicalis
snoRNA name SNORD59
alias
chromosome ⁄ contig scaffold_101
locus ⁄ host gene atp5b
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved