snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD73
sequence
AATGAATGATGACAAAATGTTTCGGTCCCAAATGATTTCTATGATTACTCTTTGAGATC
GTTCTGACATT
  Box motif
  Complementary to target RNA
length 70
organism Xenopus_tropicalis
snoRNA name SNORD73
alias
chromosome ⁄ contig scaffold_60
locus ⁄ host gene rps3a
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved